ID: 1019003360

View in Genome Browser
Species Human (GRCh38)
Location 6:168775225-168775247
Sequence GGTCTGTGTGAATTACCGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019003360_1019003366 5 Left 1019003360 6:168775225-168775247 CCTGACGGTAATTCACACAGACC No data
Right 1019003366 6:168775253-168775275 TTGCTGAGAGAGGTGAGCCATGG No data
1019003360_1019003368 18 Left 1019003360 6:168775225-168775247 CCTGACGGTAATTCACACAGACC No data
Right 1019003368 6:168775266-168775288 TGAGCCATGGCTCCAGTGCCGGG No data
1019003360_1019003367 17 Left 1019003360 6:168775225-168775247 CCTGACGGTAATTCACACAGACC No data
Right 1019003367 6:168775265-168775287 GTGAGCCATGGCTCCAGTGCCGG No data
1019003360_1019003364 -5 Left 1019003360 6:168775225-168775247 CCTGACGGTAATTCACACAGACC No data
Right 1019003364 6:168775243-168775265 AGACCAGGGGTTGCTGAGAGAGG No data
1019003360_1019003369 19 Left 1019003360 6:168775225-168775247 CCTGACGGTAATTCACACAGACC No data
Right 1019003369 6:168775267-168775289 GAGCCATGGCTCCAGTGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019003360 Original CRISPR GGTCTGTGTGAATTACCGTC AGG (reversed) Intergenic
No off target data available for this crispr