ID: 1019003364

View in Genome Browser
Species Human (GRCh38)
Location 6:168775243-168775265
Sequence AGACCAGGGGTTGCTGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019003360_1019003364 -5 Left 1019003360 6:168775225-168775247 CCTGACGGTAATTCACACAGACC No data
Right 1019003364 6:168775243-168775265 AGACCAGGGGTTGCTGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019003364 Original CRISPR AGACCAGGGGTTGCTGAGAG AGG Intergenic
No off target data available for this crispr