ID: 1019004844

View in Genome Browser
Species Human (GRCh38)
Location 6:168788121-168788143
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019004844_1019004849 0 Left 1019004844 6:168788121-168788143 CCTTTCCTCTGCAGTGTTGGGCA No data
Right 1019004849 6:168788144-168788166 CTGGGTTGGCATTTTCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019004844 Original CRISPR TGCCCAACACTGCAGAGGAA AGG (reversed) Intergenic
No off target data available for this crispr