ID: 1019005061

View in Genome Browser
Species Human (GRCh38)
Location 6:168789900-168789922
Sequence GGCAATTAAATGCCTCCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019005061_1019005065 25 Left 1019005061 6:168789900-168789922 CCAGATGGAGGCATTTAATTGCC No data
Right 1019005065 6:168789948-168789970 CTGCCCTTGCTTGCAGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019005061 Original CRISPR GGCAATTAAATGCCTCCATC TGG (reversed) Intergenic
No off target data available for this crispr