ID: 1019005366

View in Genome Browser
Species Human (GRCh38)
Location 6:168792316-168792338
Sequence AAGGCTCTGAAAGGTGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019005362_1019005366 -9 Left 1019005362 6:168792302-168792324 CCAAAACCTTCCACAAGGCTCTG No data
Right 1019005366 6:168792316-168792338 AAGGCTCTGAAAGGTGTTTCTGG No data
1019005360_1019005366 15 Left 1019005360 6:168792278-168792300 CCTGCAAATGTTAAATGTTTAAT No data
Right 1019005366 6:168792316-168792338 AAGGCTCTGAAAGGTGTTTCTGG No data
1019005359_1019005366 27 Left 1019005359 6:168792266-168792288 CCTCTTTCAAAACCTGCAAATGT No data
Right 1019005366 6:168792316-168792338 AAGGCTCTGAAAGGTGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019005366 Original CRISPR AAGGCTCTGAAAGGTGTTTC TGG Intergenic
No off target data available for this crispr