ID: 1019010399

View in Genome Browser
Species Human (GRCh38)
Location 6:168839933-168839955
Sequence CAGTGTTTCCACAAGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019010386_1019010399 25 Left 1019010386 6:168839885-168839907 CCCAAGAAGGCCGATGGGTTTAG No data
Right 1019010399 6:168839933-168839955 CAGTGTTTCCACAAGGTGGTAGG No data
1019010387_1019010399 24 Left 1019010387 6:168839886-168839908 CCAAGAAGGCCGATGGGTTTAGG No data
Right 1019010399 6:168839933-168839955 CAGTGTTTCCACAAGGTGGTAGG No data
1019010393_1019010399 15 Left 1019010393 6:168839895-168839917 CCGATGGGTTTAGGGTGGGAGGA No data
Right 1019010399 6:168839933-168839955 CAGTGTTTCCACAAGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019010399 Original CRISPR CAGTGTTTCCACAAGGTGGT AGG Intergenic
No off target data available for this crispr