ID: 1019010613

View in Genome Browser
Species Human (GRCh38)
Location 6:168841326-168841348
Sequence ACCAGGGAGTCGAGGATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019010609_1019010613 -7 Left 1019010609 6:168841310-168841332 CCAGGGAGGCGCAGGAACCAGGG No data
Right 1019010613 6:168841326-168841348 ACCAGGGAGTCGAGGATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019010613 Original CRISPR ACCAGGGAGTCGAGGATCCA GGG Intergenic
No off target data available for this crispr