ID: 1019011520

View in Genome Browser
Species Human (GRCh38)
Location 6:168847219-168847241
Sequence CAAGAGAAACAGCTGGCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019011520_1019011525 -4 Left 1019011520 6:168847219-168847241 CCGGGGGCCAGCTGTTTCTCTTG No data
Right 1019011525 6:168847238-168847260 CTTGTCTACTGATGGTGCCGGGG No data
1019011520_1019011526 -3 Left 1019011520 6:168847219-168847241 CCGGGGGCCAGCTGTTTCTCTTG No data
Right 1019011526 6:168847239-168847261 TTGTCTACTGATGGTGCCGGGGG No data
1019011520_1019011524 -5 Left 1019011520 6:168847219-168847241 CCGGGGGCCAGCTGTTTCTCTTG No data
Right 1019011524 6:168847237-168847259 TCTTGTCTACTGATGGTGCCGGG No data
1019011520_1019011530 25 Left 1019011520 6:168847219-168847241 CCGGGGGCCAGCTGTTTCTCTTG No data
Right 1019011530 6:168847267-168847289 CTGTTTCTCTTGTCTACTGATGG No data
1019011520_1019011527 2 Left 1019011520 6:168847219-168847241 CCGGGGGCCAGCTGTTTCTCTTG No data
Right 1019011527 6:168847244-168847266 TACTGATGGTGCCGGGGGTCCGG No data
1019011520_1019011523 -6 Left 1019011520 6:168847219-168847241 CCGGGGGCCAGCTGTTTCTCTTG No data
Right 1019011523 6:168847236-168847258 CTCTTGTCTACTGATGGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019011520 Original CRISPR CAAGAGAAACAGCTGGCCCC CGG (reversed) Intergenic
No off target data available for this crispr