ID: 1019011590

View in Genome Browser
Species Human (GRCh38)
Location 6:168847552-168847574
Sequence CAAGAGAAACAGCTGGCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019011590_1019011596 -3 Left 1019011590 6:168847552-168847574 CCGGGGGCCAGCTGTTTCTCTTG No data
Right 1019011596 6:168847572-168847594 TTGTCTACTGATGGTGCCGGGGG No data
1019011590_1019011595 -4 Left 1019011590 6:168847552-168847574 CCGGGGGCCAGCTGTTTCTCTTG No data
Right 1019011595 6:168847571-168847593 CTTGTCTACTGATGGTGCCGGGG No data
1019011590_1019011593 -6 Left 1019011590 6:168847552-168847574 CCGGGGGCCAGCTGTTTCTCTTG No data
Right 1019011593 6:168847569-168847591 CTCTTGTCTACTGATGGTGCCGG No data
1019011590_1019011594 -5 Left 1019011590 6:168847552-168847574 CCGGGGGCCAGCTGTTTCTCTTG No data
Right 1019011594 6:168847570-168847592 TCTTGTCTACTGATGGTGCCGGG No data
1019011590_1019011599 25 Left 1019011590 6:168847552-168847574 CCGGGGGCCAGCTGTTTCTCTTG No data
Right 1019011599 6:168847600-168847622 CTCTTTCTGTTGTCTACTGATGG No data
1019011590_1019011597 2 Left 1019011590 6:168847552-168847574 CCGGGGGCCAGCTGTTTCTCTTG No data
Right 1019011597 6:168847577-168847599 TACTGATGGTGCCGGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019011590 Original CRISPR CAAGAGAAACAGCTGGCCCC CGG (reversed) Intergenic
No off target data available for this crispr