ID: 1019011593

View in Genome Browser
Species Human (GRCh38)
Location 6:168847569-168847591
Sequence CTCTTGTCTACTGATGGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019011584_1019011593 23 Left 1019011584 6:168847523-168847545 CCGGCTGTTTCTGTTGTCTATTG No data
Right 1019011593 6:168847569-168847591 CTCTTGTCTACTGATGGTGCCGG No data
1019011590_1019011593 -6 Left 1019011590 6:168847552-168847574 CCGGGGGCCAGCTGTTTCTCTTG No data
Right 1019011593 6:168847569-168847591 CTCTTGTCTACTGATGGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019011593 Original CRISPR CTCTTGTCTACTGATGGTGC CGG Intergenic
No off target data available for this crispr