ID: 1019011599

View in Genome Browser
Species Human (GRCh38)
Location 6:168847600-168847622
Sequence CTCTTTCTGTTGTCTACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019011591_1019011599 18 Left 1019011591 6:168847559-168847581 CCAGCTGTTTCTCTTGTCTACTG No data
Right 1019011599 6:168847600-168847622 CTCTTTCTGTTGTCTACTGATGG No data
1019011590_1019011599 25 Left 1019011590 6:168847552-168847574 CCGGGGGCCAGCTGTTTCTCTTG No data
Right 1019011599 6:168847600-168847622 CTCTTTCTGTTGTCTACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019011599 Original CRISPR CTCTTTCTGTTGTCTACTGA TGG Intergenic
No off target data available for this crispr