ID: 1019015678

View in Genome Browser
Species Human (GRCh38)
Location 6:168878194-168878216
Sequence GAAATGTCCACACCCAGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019015675_1019015678 -7 Left 1019015675 6:168878178-168878200 CCACCTTGGACTAAAGGAAATGT No data
Right 1019015678 6:168878194-168878216 GAAATGTCCACACCCAGCTTGGG No data
1019015673_1019015678 6 Left 1019015673 6:168878165-168878187 CCGTAAGGCGAAGCCACCTTGGA No data
Right 1019015678 6:168878194-168878216 GAAATGTCCACACCCAGCTTGGG No data
1019015671_1019015678 19 Left 1019015671 6:168878152-168878174 CCGACGTAGTAAACCGTAAGGCG No data
Right 1019015678 6:168878194-168878216 GAAATGTCCACACCCAGCTTGGG No data
1019015670_1019015678 20 Left 1019015670 6:168878151-168878173 CCCGACGTAGTAAACCGTAAGGC No data
Right 1019015678 6:168878194-168878216 GAAATGTCCACACCCAGCTTGGG No data
1019015676_1019015678 -10 Left 1019015676 6:168878181-168878203 CCTTGGACTAAAGGAAATGTCCA No data
Right 1019015678 6:168878194-168878216 GAAATGTCCACACCCAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019015678 Original CRISPR GAAATGTCCACACCCAGCTT GGG Intergenic
No off target data available for this crispr