ID: 1019017630

View in Genome Browser
Species Human (GRCh38)
Location 6:168891378-168891400
Sequence TCCTCTCCTTTGCTTCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019017629_1019017630 4 Left 1019017629 6:168891351-168891373 CCTGATACTCTGGCTGGGATGCT No data
Right 1019017630 6:168891378-168891400 TCCTCTCCTTTGCTTCTGCCTGG No data
1019017625_1019017630 17 Left 1019017625 6:168891338-168891360 CCTGTGCTGGGTGCCTGATACTC No data
Right 1019017630 6:168891378-168891400 TCCTCTCCTTTGCTTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019017630 Original CRISPR TCCTCTCCTTTGCTTCTGCC TGG Intergenic
No off target data available for this crispr