ID: 1019020547

View in Genome Browser
Species Human (GRCh38)
Location 6:168914164-168914186
Sequence AAGTCTGGGCAGATGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019020542_1019020547 1 Left 1019020542 6:168914140-168914162 CCTGCCTGAGAGCACAGGACTGC No data
Right 1019020547 6:168914164-168914186 AAGTCTGGGCAGATGGAAGCAGG No data
1019020541_1019020547 2 Left 1019020541 6:168914139-168914161 CCCTGCCTGAGAGCACAGGACTG No data
Right 1019020547 6:168914164-168914186 AAGTCTGGGCAGATGGAAGCAGG No data
1019020543_1019020547 -3 Left 1019020543 6:168914144-168914166 CCTGAGAGCACAGGACTGCTAAG No data
Right 1019020547 6:168914164-168914186 AAGTCTGGGCAGATGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019020547 Original CRISPR AAGTCTGGGCAGATGGAAGC AGG Intergenic
No off target data available for this crispr