ID: 1019024820

View in Genome Browser
Species Human (GRCh38)
Location 6:168950683-168950705
Sequence CACAGAAGGGTGCAGGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019024820_1019024830 24 Left 1019024820 6:168950683-168950705 CCAGACCCCTGCACCCTTCTGTG No data
Right 1019024830 6:168950730-168950752 GCAGTGTGAAGTTGCCACGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019024820 Original CRISPR CACAGAAGGGTGCAGGGGTC TGG (reversed) Intergenic
No off target data available for this crispr