ID: 1019025114

View in Genome Browser
Species Human (GRCh38)
Location 6:168954820-168954842
Sequence TTCCAAATGTTCATTATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019025114_1019025117 19 Left 1019025114 6:168954820-168954842 CCTGTAATAATGAACATTTGGAA No data
Right 1019025117 6:168954862-168954884 GTCATTTGCACAACATGGCTGGG No data
1019025114_1019025119 27 Left 1019025114 6:168954820-168954842 CCTGTAATAATGAACATTTGGAA No data
Right 1019025119 6:168954870-168954892 CACAACATGGCTGGGCCTGGAGG No data
1019025114_1019025116 18 Left 1019025114 6:168954820-168954842 CCTGTAATAATGAACATTTGGAA No data
Right 1019025116 6:168954861-168954883 TGTCATTTGCACAACATGGCTGG No data
1019025114_1019025118 24 Left 1019025114 6:168954820-168954842 CCTGTAATAATGAACATTTGGAA No data
Right 1019025118 6:168954867-168954889 TTGCACAACATGGCTGGGCCTGG No data
1019025114_1019025115 14 Left 1019025114 6:168954820-168954842 CCTGTAATAATGAACATTTGGAA No data
Right 1019025115 6:168954857-168954879 AAAATGTCATTTGCACAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019025114 Original CRISPR TTCCAAATGTTCATTATTAC AGG (reversed) Intergenic
No off target data available for this crispr