ID: 1019025116

View in Genome Browser
Species Human (GRCh38)
Location 6:168954861-168954883
Sequence TGTCATTTGCACAACATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019025114_1019025116 18 Left 1019025114 6:168954820-168954842 CCTGTAATAATGAACATTTGGAA No data
Right 1019025116 6:168954861-168954883 TGTCATTTGCACAACATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019025116 Original CRISPR TGTCATTTGCACAACATGGC TGG Intergenic
No off target data available for this crispr