ID: 1019025822

View in Genome Browser
Species Human (GRCh38)
Location 6:168962304-168962326
Sequence GCTCATCTGCACAGGGTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019025822_1019025833 7 Left 1019025822 6:168962304-168962326 CCACCAACCCTGTGCAGATGAGC No data
Right 1019025833 6:168962334-168962356 CAGCCCCAGCACCGGGTGGCCGG No data
1019025822_1019025839 22 Left 1019025822 6:168962304-168962326 CCACCAACCCTGTGCAGATGAGC No data
Right 1019025839 6:168962349-168962371 GTGGCCGGTGGCCACAGAGATGG No data
1019025822_1019025830 0 Left 1019025822 6:168962304-168962326 CCACCAACCCTGTGCAGATGAGC No data
Right 1019025830 6:168962327-168962349 TGGGGACCAGCCCCAGCACCGGG No data
1019025822_1019025831 3 Left 1019025822 6:168962304-168962326 CCACCAACCCTGTGCAGATGAGC No data
Right 1019025831 6:168962330-168962352 GGACCAGCCCCAGCACCGGGTGG No data
1019025822_1019025835 10 Left 1019025822 6:168962304-168962326 CCACCAACCCTGTGCAGATGAGC No data
Right 1019025835 6:168962337-168962359 CCCCAGCACCGGGTGGCCGGTGG No data
1019025822_1019025829 -1 Left 1019025822 6:168962304-168962326 CCACCAACCCTGTGCAGATGAGC No data
Right 1019025829 6:168962326-168962348 CTGGGGACCAGCCCCAGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019025822 Original CRISPR GCTCATCTGCACAGGGTTGG TGG (reversed) Intergenic
No off target data available for this crispr