ID: 1019026669

View in Genome Browser
Species Human (GRCh38)
Location 6:168971381-168971403
Sequence TGCCCCAGTGGACCAAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019026669_1019026676 24 Left 1019026669 6:168971381-168971403 CCAACTTTTGGTCCACTGGGGCA No data
Right 1019026676 6:168971428-168971450 TGGGCAGGGGCCATGCCCCCAGG No data
1019026669_1019026671 4 Left 1019026669 6:168971381-168971403 CCAACTTTTGGTCCACTGGGGCA No data
Right 1019026671 6:168971408-168971430 ACTTGTCTGCACAGCTCTGCTGG No data
1019026669_1019026674 10 Left 1019026669 6:168971381-168971403 CCAACTTTTGGTCCACTGGGGCA No data
Right 1019026674 6:168971414-168971436 CTGCACAGCTCTGCTGGGCAGGG No data
1019026669_1019026673 9 Left 1019026669 6:168971381-168971403 CCAACTTTTGGTCCACTGGGGCA No data
Right 1019026673 6:168971413-168971435 TCTGCACAGCTCTGCTGGGCAGG No data
1019026669_1019026675 11 Left 1019026669 6:168971381-168971403 CCAACTTTTGGTCCACTGGGGCA No data
Right 1019026675 6:168971415-168971437 TGCACAGCTCTGCTGGGCAGGGG No data
1019026669_1019026672 5 Left 1019026669 6:168971381-168971403 CCAACTTTTGGTCCACTGGGGCA No data
Right 1019026672 6:168971409-168971431 CTTGTCTGCACAGCTCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019026669 Original CRISPR TGCCCCAGTGGACCAAAAGT TGG (reversed) Intergenic
No off target data available for this crispr