ID: 1019029090

View in Genome Browser
Species Human (GRCh38)
Location 6:168995046-168995068
Sequence GGGCGGGCCAATGCCAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019029083_1019029090 2 Left 1019029083 6:168995021-168995043 CCACTTTTAATTACATGCAAGTT No data
Right 1019029090 6:168995046-168995068 GGGCGGGCCAATGCCAATGGAGG No data
1019029081_1019029090 25 Left 1019029081 6:168994998-168995020 CCTGTATTTTTACTCACTTATAC No data
Right 1019029090 6:168995046-168995068 GGGCGGGCCAATGCCAATGGAGG No data
1019029082_1019029090 3 Left 1019029082 6:168995020-168995042 CCCACTTTTAATTACATGCAAGT 0: 4
1: 75
2: 182
3: 296
4: 396
Right 1019029090 6:168995046-168995068 GGGCGGGCCAATGCCAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019029090 Original CRISPR GGGCGGGCCAATGCCAATGG AGG Intergenic
No off target data available for this crispr