ID: 1019029884

View in Genome Browser
Species Human (GRCh38)
Location 6:169000869-169000891
Sequence TGAGACCCCATGGGGAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019029878_1019029884 2 Left 1019029878 6:169000844-169000866 CCTCTGGGTTTGTTCCAACTCCT No data
Right 1019029884 6:169000869-169000891 TGAGACCCCATGGGGAAAACAGG No data
1019029877_1019029884 3 Left 1019029877 6:169000843-169000865 CCCTCTGGGTTTGTTCCAACTCC No data
Right 1019029884 6:169000869-169000891 TGAGACCCCATGGGGAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019029884 Original CRISPR TGAGACCCCATGGGGAAAAC AGG Intergenic
No off target data available for this crispr