ID: 1019033046

View in Genome Browser
Species Human (GRCh38)
Location 6:169030082-169030104
Sequence GAGAGGACCAGCCCCCTCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019033046_1019033051 0 Left 1019033046 6:169030082-169030104 CCTCGGAGGGGGCTGGTCCTCTC No data
Right 1019033051 6:169030105-169030127 GTACATGGCCAGGCAGCACTGGG No data
1019033046_1019033050 -1 Left 1019033046 6:169030082-169030104 CCTCGGAGGGGGCTGGTCCTCTC No data
Right 1019033050 6:169030104-169030126 CGTACATGGCCAGGCAGCACTGG No data
1019033046_1019033048 -10 Left 1019033046 6:169030082-169030104 CCTCGGAGGGGGCTGGTCCTCTC No data
Right 1019033048 6:169030095-169030117 TGGTCCTCTCGTACATGGCCAGG No data
1019033046_1019033052 1 Left 1019033046 6:169030082-169030104 CCTCGGAGGGGGCTGGTCCTCTC No data
Right 1019033052 6:169030106-169030128 TACATGGCCAGGCAGCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019033046 Original CRISPR GAGAGGACCAGCCCCCTCCG AGG (reversed) Intergenic
No off target data available for this crispr