ID: 1019033099

View in Genome Browser
Species Human (GRCh38)
Location 6:169030546-169030568
Sequence GGAAGGCGGGGAGCCCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019033099_1019033108 10 Left 1019033099 6:169030546-169030568 CCCACTGGGGCTCCCCGCCTTCC No data
Right 1019033108 6:169030579-169030601 TGTCCCATGCCAGGATGCCTAGG No data
1019033099_1019033109 11 Left 1019033099 6:169030546-169030568 CCCACTGGGGCTCCCCGCCTTCC No data
Right 1019033109 6:169030580-169030602 GTCCCATGCCAGGATGCCTAGGG No data
1019033099_1019033107 1 Left 1019033099 6:169030546-169030568 CCCACTGGGGCTCCCCGCCTTCC No data
Right 1019033107 6:169030570-169030592 CTCGGATGCTGTCCCATGCCAGG No data
1019033099_1019033110 12 Left 1019033099 6:169030546-169030568 CCCACTGGGGCTCCCCGCCTTCC No data
Right 1019033110 6:169030581-169030603 TCCCATGCCAGGATGCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019033099 Original CRISPR GGAAGGCGGGGAGCCCCAGT GGG (reversed) Intergenic