ID: 1019038333

View in Genome Browser
Species Human (GRCh38)
Location 6:169082095-169082117
Sequence GTGTCTTATTTTTGGTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019038333_1019038339 22 Left 1019038333 6:169082095-169082117 CCAACCAACCAAAAATAAGACAC No data
Right 1019038339 6:169082140-169082162 ATTTTCTTCACTCAGTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019038333 Original CRISPR GTGTCTTATTTTTGGTTGGT TGG (reversed) Intergenic
No off target data available for this crispr