ID: 1019038572

View in Genome Browser
Species Human (GRCh38)
Location 6:169083692-169083714
Sequence GCCTGTATGTTGCACAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019038572_1019038576 -1 Left 1019038572 6:169083692-169083714 CCATTTTTGTGCAACATACAGGC No data
Right 1019038576 6:169083714-169083736 CCTCACTGGAACTGAAACCTGGG No data
1019038572_1019038574 -2 Left 1019038572 6:169083692-169083714 CCATTTTTGTGCAACATACAGGC No data
Right 1019038574 6:169083713-169083735 GCCTCACTGGAACTGAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019038572 Original CRISPR GCCTGTATGTTGCACAAAAA TGG (reversed) Intergenic
No off target data available for this crispr