ID: 1019038624

View in Genome Browser
Species Human (GRCh38)
Location 6:169084180-169084202
Sequence GTAGCAGCCCCGTTACATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019038624_1019038632 20 Left 1019038624 6:169084180-169084202 CCACCATGTAACGGGGCTGCTAC No data
Right 1019038632 6:169084223-169084245 CTTTTGTGGGAAAGAGTTTCTGG No data
1019038624_1019038633 21 Left 1019038624 6:169084180-169084202 CCACCATGTAACGGGGCTGCTAC No data
Right 1019038633 6:169084224-169084246 TTTTGTGGGAAAGAGTTTCTGGG No data
1019038624_1019038628 6 Left 1019038624 6:169084180-169084202 CCACCATGTAACGGGGCTGCTAC No data
Right 1019038628 6:169084209-169084231 ATTTCCAATACCAGCTTTTGTGG No data
1019038624_1019038629 7 Left 1019038624 6:169084180-169084202 CCACCATGTAACGGGGCTGCTAC No data
Right 1019038629 6:169084210-169084232 TTTCCAATACCAGCTTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019038624 Original CRISPR GTAGCAGCCCCGTTACATGG TGG (reversed) Intergenic
No off target data available for this crispr