ID: 1019040040

View in Genome Browser
Species Human (GRCh38)
Location 6:169096157-169096179
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019040040_1019040054 8 Left 1019040040 6:169096157-169096179 CCCTCCTCCCTCCTCACCCCCCA No data
Right 1019040054 6:169096188-169096210 TGAATTTGTTTCTGTCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019040040 Original CRISPR TGGGGGGTGAGGAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr