ID: 1019040455

View in Genome Browser
Species Human (GRCh38)
Location 6:169099834-169099856
Sequence GATGTTGCCACCACTGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019040455_1019040468 22 Left 1019040455 6:169099834-169099856 CCACCCCCAGTGGTGGCAACATC No data
Right 1019040468 6:169099879-169099901 TCAGCCTTTCCACCTTTGTTTGG No data
1019040455_1019040469 23 Left 1019040455 6:169099834-169099856 CCACCCCCAGTGGTGGCAACATC No data
Right 1019040469 6:169099880-169099902 CAGCCTTTCCACCTTTGTTTGGG No data
1019040455_1019040470 24 Left 1019040455 6:169099834-169099856 CCACCCCCAGTGGTGGCAACATC No data
Right 1019040470 6:169099881-169099903 AGCCTTTCCACCTTTGTTTGGGG 0: 4
1: 149
2: 140
3: 124
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019040455 Original CRISPR GATGTTGCCACCACTGGGGG TGG (reversed) Intergenic
No off target data available for this crispr