ID: 1019042373

View in Genome Browser
Species Human (GRCh38)
Location 6:169117869-169117891
Sequence CTGTCTCGAGGCCCGTGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019042362_1019042373 27 Left 1019042362 6:169117819-169117841 CCCTCTCCCACAGGGGGTTGAGA No data
Right 1019042373 6:169117869-169117891 CTGTCTCGAGGCCCGTGAAGTGG No data
1019042365_1019042373 20 Left 1019042365 6:169117826-169117848 CCACAGGGGGTTGAGAGCTGTAG No data
Right 1019042373 6:169117869-169117891 CTGTCTCGAGGCCCGTGAAGTGG No data
1019042368_1019042373 -4 Left 1019042368 6:169117850-169117872 CCAAGTAAATGAGGCACCCCTGT No data
Right 1019042373 6:169117869-169117891 CTGTCTCGAGGCCCGTGAAGTGG No data
1019042364_1019042373 21 Left 1019042364 6:169117825-169117847 CCCACAGGGGGTTGAGAGCTGTA No data
Right 1019042373 6:169117869-169117891 CTGTCTCGAGGCCCGTGAAGTGG No data
1019042363_1019042373 26 Left 1019042363 6:169117820-169117842 CCTCTCCCACAGGGGGTTGAGAG No data
Right 1019042373 6:169117869-169117891 CTGTCTCGAGGCCCGTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019042373 Original CRISPR CTGTCTCGAGGCCCGTGAAG TGG Intergenic
No off target data available for this crispr