ID: 1019043224

View in Genome Browser
Species Human (GRCh38)
Location 6:169123209-169123231
Sequence TTTAAGAACTTTCCGTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019043224_1019043232 23 Left 1019043224 6:169123209-169123231 CCAACCAACGGAAAGTTCTTAAA No data
Right 1019043232 6:169123255-169123277 GGTAAGAAAAAAACCTAAATTGG No data
1019043224_1019043228 2 Left 1019043224 6:169123209-169123231 CCAACCAACGGAAAGTTCTTAAA No data
Right 1019043228 6:169123234-169123256 CCTTCCTCAGGCCTTCCACTAGG No data
1019043224_1019043226 -10 Left 1019043224 6:169123209-169123231 CCAACCAACGGAAAGTTCTTAAA No data
Right 1019043226 6:169123222-169123244 AGTTCTTAAAAGCCTTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019043224 Original CRISPR TTTAAGAACTTTCCGTTGGT TGG (reversed) Intergenic
No off target data available for this crispr