ID: 1019043226

View in Genome Browser
Species Human (GRCh38)
Location 6:169123222-169123244
Sequence AGTTCTTAAAAGCCTTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019043224_1019043226 -10 Left 1019043224 6:169123209-169123231 CCAACCAACGGAAAGTTCTTAAA No data
Right 1019043226 6:169123222-169123244 AGTTCTTAAAAGCCTTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019043226 Original CRISPR AGTTCTTAAAAGCCTTCCTC AGG Intergenic
No off target data available for this crispr