ID: 1019043228

View in Genome Browser
Species Human (GRCh38)
Location 6:169123234-169123256
Sequence CCTTCCTCAGGCCTTCCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019043224_1019043228 2 Left 1019043224 6:169123209-169123231 CCAACCAACGGAAAGTTCTTAAA No data
Right 1019043228 6:169123234-169123256 CCTTCCTCAGGCCTTCCACTAGG No data
1019043225_1019043228 -2 Left 1019043225 6:169123213-169123235 CCAACGGAAAGTTCTTAAAAGCC No data
Right 1019043228 6:169123234-169123256 CCTTCCTCAGGCCTTCCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019043228 Original CRISPR CCTTCCTCAGGCCTTCCACT AGG Intergenic
No off target data available for this crispr