ID: 1019043232

View in Genome Browser
Species Human (GRCh38)
Location 6:169123255-169123277
Sequence GGTAAGAAAAAAACCTAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019043227_1019043232 -2 Left 1019043227 6:169123234-169123256 CCTTCCTCAGGCCTTCCACTAGG No data
Right 1019043232 6:169123255-169123277 GGTAAGAAAAAAACCTAAATTGG No data
1019043229_1019043232 -6 Left 1019043229 6:169123238-169123260 CCTCAGGCCTTCCACTAGGTAAG No data
Right 1019043232 6:169123255-169123277 GGTAAGAAAAAAACCTAAATTGG No data
1019043225_1019043232 19 Left 1019043225 6:169123213-169123235 CCAACGGAAAGTTCTTAAAAGCC No data
Right 1019043232 6:169123255-169123277 GGTAAGAAAAAAACCTAAATTGG No data
1019043224_1019043232 23 Left 1019043224 6:169123209-169123231 CCAACCAACGGAAAGTTCTTAAA No data
Right 1019043232 6:169123255-169123277 GGTAAGAAAAAAACCTAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019043232 Original CRISPR GGTAAGAAAAAAACCTAAAT TGG Intergenic
No off target data available for this crispr