ID: 1019047363

View in Genome Browser
Species Human (GRCh38)
Location 6:169159403-169159425
Sequence GCCCTGCCGCATCTCTGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019047357_1019047363 1 Left 1019047357 6:169159379-169159401 CCAGCGGTTCTGTGCCGCCAGCA No data
Right 1019047363 6:169159403-169159425 GCCCTGCCGCATCTCTGGGCTGG No data
1019047352_1019047363 28 Left 1019047352 6:169159352-169159374 CCACGGCCTTGGGATCTGGACGA No data
Right 1019047363 6:169159403-169159425 GCCCTGCCGCATCTCTGGGCTGG No data
1019047355_1019047363 3 Left 1019047355 6:169159377-169159399 CCCCAGCGGTTCTGTGCCGCCAG No data
Right 1019047363 6:169159403-169159425 GCCCTGCCGCATCTCTGGGCTGG No data
1019047356_1019047363 2 Left 1019047356 6:169159378-169159400 CCCAGCGGTTCTGTGCCGCCAGC No data
Right 1019047363 6:169159403-169159425 GCCCTGCCGCATCTCTGGGCTGG No data
1019047353_1019047363 22 Left 1019047353 6:169159358-169159380 CCTTGGGATCTGGACGACACCCC No data
Right 1019047363 6:169159403-169159425 GCCCTGCCGCATCTCTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019047363 Original CRISPR GCCCTGCCGCATCTCTGGGC TGG Intergenic
No off target data available for this crispr