ID: 1019048911

View in Genome Browser
Species Human (GRCh38)
Location 6:169168428-169168450
Sequence CCTGGCGCCGCCGCCGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019048911_1019048923 21 Left 1019048911 6:169168428-169168450 CCCAGGGCGGCGGCGGCGCCAGG No data
Right 1019048923 6:169168472-169168494 GGGACTTGCCTGCTGACCTGGGG No data
1019048911_1019048917 0 Left 1019048911 6:169168428-169168450 CCCAGGGCGGCGGCGGCGCCAGG No data
Right 1019048917 6:169168451-169168473 CAGGCGCGGATCCCGCTGCGAGG No data
1019048911_1019048926 29 Left 1019048911 6:169168428-169168450 CCCAGGGCGGCGGCGGCGCCAGG No data
Right 1019048926 6:169168480-169168502 CCTGCTGACCTGGGGCCGCAGGG No data
1019048911_1019048924 28 Left 1019048911 6:169168428-169168450 CCCAGGGCGGCGGCGGCGCCAGG No data
Right 1019048924 6:169168479-169168501 GCCTGCTGACCTGGGGCCGCAGG No data
1019048911_1019048921 19 Left 1019048911 6:169168428-169168450 CCCAGGGCGGCGGCGGCGCCAGG No data
Right 1019048921 6:169168470-169168492 GAGGGACTTGCCTGCTGACCTGG No data
1019048911_1019048922 20 Left 1019048911 6:169168428-169168450 CCCAGGGCGGCGGCGGCGCCAGG No data
Right 1019048922 6:169168471-169168493 AGGGACTTGCCTGCTGACCTGGG No data
1019048911_1019048918 1 Left 1019048911 6:169168428-169168450 CCCAGGGCGGCGGCGGCGCCAGG No data
Right 1019048918 6:169168452-169168474 AGGCGCGGATCCCGCTGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019048911 Original CRISPR CCTGGCGCCGCCGCCGCCCT GGG (reversed) Intergenic
No off target data available for this crispr