ID: 1019048913

View in Genome Browser
Species Human (GRCh38)
Location 6:169168429-169168451
Sequence GCCTGGCGCCGCCGCCGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019048913_1019048924 27 Left 1019048913 6:169168429-169168451 CCAGGGCGGCGGCGGCGCCAGGC No data
Right 1019048924 6:169168479-169168501 GCCTGCTGACCTGGGGCCGCAGG No data
1019048913_1019048922 19 Left 1019048913 6:169168429-169168451 CCAGGGCGGCGGCGGCGCCAGGC No data
Right 1019048922 6:169168471-169168493 AGGGACTTGCCTGCTGACCTGGG No data
1019048913_1019048917 -1 Left 1019048913 6:169168429-169168451 CCAGGGCGGCGGCGGCGCCAGGC No data
Right 1019048917 6:169168451-169168473 CAGGCGCGGATCCCGCTGCGAGG No data
1019048913_1019048923 20 Left 1019048913 6:169168429-169168451 CCAGGGCGGCGGCGGCGCCAGGC No data
Right 1019048923 6:169168472-169168494 GGGACTTGCCTGCTGACCTGGGG No data
1019048913_1019048918 0 Left 1019048913 6:169168429-169168451 CCAGGGCGGCGGCGGCGCCAGGC No data
Right 1019048918 6:169168452-169168474 AGGCGCGGATCCCGCTGCGAGGG No data
1019048913_1019048926 28 Left 1019048913 6:169168429-169168451 CCAGGGCGGCGGCGGCGCCAGGC No data
Right 1019048926 6:169168480-169168502 CCTGCTGACCTGGGGCCGCAGGG No data
1019048913_1019048921 18 Left 1019048913 6:169168429-169168451 CCAGGGCGGCGGCGGCGCCAGGC No data
Right 1019048921 6:169168470-169168492 GAGGGACTTGCCTGCTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019048913 Original CRISPR GCCTGGCGCCGCCGCCGCCC TGG (reversed) Intergenic
No off target data available for this crispr