ID: 1019048916

View in Genome Browser
Species Human (GRCh38)
Location 6:169168446-169168468
Sequence CAGCGGGATCCGCGCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019048916_1019048922 2 Left 1019048916 6:169168446-169168468 CCAGGCAGGCGCGGATCCCGCTG No data
Right 1019048922 6:169168471-169168493 AGGGACTTGCCTGCTGACCTGGG No data
1019048916_1019048924 10 Left 1019048916 6:169168446-169168468 CCAGGCAGGCGCGGATCCCGCTG No data
Right 1019048924 6:169168479-169168501 GCCTGCTGACCTGGGGCCGCAGG No data
1019048916_1019048926 11 Left 1019048916 6:169168446-169168468 CCAGGCAGGCGCGGATCCCGCTG No data
Right 1019048926 6:169168480-169168502 CCTGCTGACCTGGGGCCGCAGGG No data
1019048916_1019048923 3 Left 1019048916 6:169168446-169168468 CCAGGCAGGCGCGGATCCCGCTG No data
Right 1019048923 6:169168472-169168494 GGGACTTGCCTGCTGACCTGGGG No data
1019048916_1019048929 28 Left 1019048916 6:169168446-169168468 CCAGGCAGGCGCGGATCCCGCTG No data
Right 1019048929 6:169168497-169168519 GCAGGGAGCTCTGCTTTATCAGG No data
1019048916_1019048921 1 Left 1019048916 6:169168446-169168468 CCAGGCAGGCGCGGATCCCGCTG No data
Right 1019048921 6:169168470-169168492 GAGGGACTTGCCTGCTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019048916 Original CRISPR CAGCGGGATCCGCGCCTGCC TGG (reversed) Intergenic
No off target data available for this crispr