ID: 1019048918

View in Genome Browser
Species Human (GRCh38)
Location 6:169168452-169168474
Sequence AGGCGCGGATCCCGCTGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019048913_1019048918 0 Left 1019048913 6:169168429-169168451 CCAGGGCGGCGGCGGCGCCAGGC No data
Right 1019048918 6:169168452-169168474 AGGCGCGGATCCCGCTGCGAGGG No data
1019048911_1019048918 1 Left 1019048911 6:169168428-169168450 CCCAGGGCGGCGGCGGCGCCAGG No data
Right 1019048918 6:169168452-169168474 AGGCGCGGATCCCGCTGCGAGGG No data
1019048905_1019048918 24 Left 1019048905 6:169168405-169168427 CCACAGTGAAATTGCTGCGTGCG No data
Right 1019048918 6:169168452-169168474 AGGCGCGGATCCCGCTGCGAGGG No data
1019048904_1019048918 25 Left 1019048904 6:169168404-169168426 CCCACAGTGAAATTGCTGCGTGC No data
Right 1019048918 6:169168452-169168474 AGGCGCGGATCCCGCTGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019048918 Original CRISPR AGGCGCGGATCCCGCTGCGA GGG Intergenic
No off target data available for this crispr