ID: 1019048919

View in Genome Browser
Species Human (GRCh38)
Location 6:169168462-169168484
Sequence GCAGGCAAGTCCCTCGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019048919_1019048924 -6 Left 1019048919 6:169168462-169168484 CCCGCTGCGAGGGACTTGCCTGC No data
Right 1019048924 6:169168479-169168501 GCCTGCTGACCTGGGGCCGCAGG No data
1019048919_1019048926 -5 Left 1019048919 6:169168462-169168484 CCCGCTGCGAGGGACTTGCCTGC No data
Right 1019048926 6:169168480-169168502 CCTGCTGACCTGGGGCCGCAGGG No data
1019048919_1019048929 12 Left 1019048919 6:169168462-169168484 CCCGCTGCGAGGGACTTGCCTGC No data
Right 1019048929 6:169168497-169168519 GCAGGGAGCTCTGCTTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019048919 Original CRISPR GCAGGCAAGTCCCTCGCAGC GGG (reversed) Intergenic
No off target data available for this crispr