ID: 1019048922

View in Genome Browser
Species Human (GRCh38)
Location 6:169168471-169168493
Sequence AGGGACTTGCCTGCTGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019048911_1019048922 20 Left 1019048911 6:169168428-169168450 CCCAGGGCGGCGGCGGCGCCAGG No data
Right 1019048922 6:169168471-169168493 AGGGACTTGCCTGCTGACCTGGG No data
1019048913_1019048922 19 Left 1019048913 6:169168429-169168451 CCAGGGCGGCGGCGGCGCCAGGC No data
Right 1019048922 6:169168471-169168493 AGGGACTTGCCTGCTGACCTGGG No data
1019048916_1019048922 2 Left 1019048916 6:169168446-169168468 CCAGGCAGGCGCGGATCCCGCTG No data
Right 1019048922 6:169168471-169168493 AGGGACTTGCCTGCTGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019048922 Original CRISPR AGGGACTTGCCTGCTGACCT GGG Intergenic
No off target data available for this crispr