ID: 1019048926

View in Genome Browser
Species Human (GRCh38)
Location 6:169168480-169168502
Sequence CCTGCTGACCTGGGGCCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019048919_1019048926 -5 Left 1019048919 6:169168462-169168484 CCCGCTGCGAGGGACTTGCCTGC No data
Right 1019048926 6:169168480-169168502 CCTGCTGACCTGGGGCCGCAGGG No data
1019048920_1019048926 -6 Left 1019048920 6:169168463-169168485 CCGCTGCGAGGGACTTGCCTGCT No data
Right 1019048926 6:169168480-169168502 CCTGCTGACCTGGGGCCGCAGGG No data
1019048916_1019048926 11 Left 1019048916 6:169168446-169168468 CCAGGCAGGCGCGGATCCCGCTG No data
Right 1019048926 6:169168480-169168502 CCTGCTGACCTGGGGCCGCAGGG No data
1019048913_1019048926 28 Left 1019048913 6:169168429-169168451 CCAGGGCGGCGGCGGCGCCAGGC No data
Right 1019048926 6:169168480-169168502 CCTGCTGACCTGGGGCCGCAGGG No data
1019048911_1019048926 29 Left 1019048911 6:169168428-169168450 CCCAGGGCGGCGGCGGCGCCAGG No data
Right 1019048926 6:169168480-169168502 CCTGCTGACCTGGGGCCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019048926 Original CRISPR CCTGCTGACCTGGGGCCGCA GGG Intergenic
No off target data available for this crispr