ID: 1019049293

View in Genome Browser
Species Human (GRCh38)
Location 6:169170755-169170777
Sequence CTGAAGATGCATGAGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019049288_1019049293 16 Left 1019049288 6:169170716-169170738 CCAGAGCAGTCAATGCGATGTGC No data
Right 1019049293 6:169170755-169170777 CTGAAGATGCATGAGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019049293 Original CRISPR CTGAAGATGCATGAGGATGA GGG Intergenic
No off target data available for this crispr