ID: 1019051372

View in Genome Browser
Species Human (GRCh38)
Location 6:169186229-169186251
Sequence GTTCCTGCACGGAGGCCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019051365_1019051372 18 Left 1019051365 6:169186188-169186210 CCTCATGAGTTCTTTGCGAGGCC No data
Right 1019051372 6:169186229-169186251 GTTCCTGCACGGAGGCCTCTAGG No data
1019051367_1019051372 -3 Left 1019051367 6:169186209-169186231 CCACGCATCCAGGTACCTGTGTT No data
Right 1019051372 6:169186229-169186251 GTTCCTGCACGGAGGCCTCTAGG No data
1019051363_1019051372 21 Left 1019051363 6:169186185-169186207 CCTCCTCATGAGTTCTTTGCGAG No data
Right 1019051372 6:169186229-169186251 GTTCCTGCACGGAGGCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019051372 Original CRISPR GTTCCTGCACGGAGGCCTCT AGG Intergenic
No off target data available for this crispr