ID: 1019052453

View in Genome Browser
Species Human (GRCh38)
Location 6:169193471-169193493
Sequence GCTTCTATGCAAAGAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019052450_1019052453 -2 Left 1019052450 6:169193450-169193472 CCTCAAATCCCAATTTTGTTGGC No data
Right 1019052453 6:169193471-169193493 GCTTCTATGCAAAGAGAAGCAGG No data
1019052451_1019052453 -10 Left 1019052451 6:169193458-169193480 CCCAATTTTGTTGGCTTCTATGC No data
Right 1019052453 6:169193471-169193493 GCTTCTATGCAAAGAGAAGCAGG No data
1019052448_1019052453 16 Left 1019052448 6:169193432-169193454 CCAGACAGAACAGTCTCTCCTCA No data
Right 1019052453 6:169193471-169193493 GCTTCTATGCAAAGAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019052453 Original CRISPR GCTTCTATGCAAAGAGAAGC AGG Intergenic
No off target data available for this crispr