ID: 1019055765

View in Genome Browser
Species Human (GRCh38)
Location 6:169222246-169222268
Sequence GTGAACTCCACCACGGGGAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 58}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019055765_1019055772 -3 Left 1019055765 6:169222246-169222268 CCCGTCCCCGTGGTGGAGTTCAC 0: 1
1: 0
2: 2
3: 5
4: 58
Right 1019055772 6:169222266-169222288 CACCACCTTGAGGGACACGCCGG 0: 1
1: 0
2: 1
3: 9
4: 105
1019055765_1019055778 19 Left 1019055765 6:169222246-169222268 CCCGTCCCCGTGGTGGAGTTCAC 0: 1
1: 0
2: 2
3: 5
4: 58
Right 1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1019055765_1019055775 9 Left 1019055765 6:169222246-169222268 CCCGTCCCCGTGGTGGAGTTCAC 0: 1
1: 0
2: 2
3: 5
4: 58
Right 1019055775 6:169222278-169222300 GGACACGCCGGAGTAGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 20
1019055765_1019055779 23 Left 1019055765 6:169222246-169222268 CCCGTCCCCGTGGTGGAGTTCAC 0: 1
1: 0
2: 2
3: 5
4: 58
Right 1019055779 6:169222292-169222314 AGCCATAGGCCCGCGTGGGCTGG 0: 1
1: 1
2: 1
3: 6
4: 85
1019055765_1019055777 18 Left 1019055765 6:169222246-169222268 CCCGTCCCCGTGGTGGAGTTCAC 0: 1
1: 0
2: 2
3: 5
4: 58
Right 1019055777 6:169222287-169222309 GGAGTAGCCATAGGCCCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019055765 Original CRISPR GTGAACTCCACCACGGGGAC GGG (reversed) Exonic
900581501 1:3412040-3412062 CTGGACACGACCACGGGGACGGG + Exonic
903279454 1:22242215-22242237 TTGAACTCCACCACCCAGACTGG - Intergenic
906589104 1:47006983-47007005 GTAGACTCCACCACTGGGGCAGG + Intergenic
909615803 1:77606569-77606591 GTGGCCACCACCACTGGGACTGG - Intronic
910949946 1:92635265-92635287 GTAGACTCCACCTCGGGGGCAGG - Intronic
911735449 1:101331726-101331748 AGGAACTCTACCATGGGGACTGG + Intergenic
1070058016 10:72953954-72953976 GTGAACTGCAGCAGGGGGAAGGG + Intronic
1076620155 10:131781927-131781949 GTGAACTCCAGCACCTGGGCTGG - Intergenic
1076894292 10:133302330-133302352 GTGAGCGCCACCCCGGGGTCAGG - Intronic
1080110681 11:28563791-28563813 CTCAACTCCACCACACGGACTGG - Intergenic
1088194279 11:107258169-107258191 GTGAAAACCACAAAGGGGACGGG + Intergenic
1090279387 11:125443029-125443051 GAAAACTCCACCACAGGGCCGGG - Intergenic
1090473057 11:126997023-126997045 CTGATCTCCACCTCGGAGACAGG - Intronic
1093919107 12:24839418-24839440 GTGAACTCAACCACAAGGCCTGG + Intronic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1104901424 12:132191288-132191310 GTGAGCTCCAGCACGGGGACTGG + Intergenic
1104901431 12:132191321-132191343 GTGAGCTCCAGCACGGGGACTGG + Intergenic
1114301751 14:21384818-21384840 ATGAACTGCAGCAAGGGGACTGG - Intergenic
1122306482 14:100769866-100769888 GTGAGCTCCAGCGCGAGGACAGG + Intergenic
1125431028 15:39593597-39593619 GTAAACTCCACCACAGGGCCTGG + Exonic
1128992477 15:72272455-72272477 GTGGCCGCCACCACGGGCACAGG - Exonic
1136130562 16:28218083-28218105 TTGCACTCCACCCTGGGGACAGG + Intergenic
1145933732 17:28703245-28703267 GTGAAATCCACTTCTGGGACAGG - Exonic
1145997696 17:29113938-29113960 GAGGGCTCCACCACGGGGAGAGG + Intronic
1147900131 17:43778564-43778586 GTGCACCCCGCCACGGGGAAGGG + Intronic
1150240617 17:63629157-63629179 CTGAACTCCAGCATGGCGACAGG - Intronic
1161114201 19:2487915-2487937 GTGATCTCCACCTCGTGGTCGGG + Intergenic
1165767371 19:38359865-38359887 GTGTTCTCCAGCACGGGGGCAGG - Intronic
1166874792 19:45890822-45890844 GTGATCTCCACCTTGGGGGCCGG + Exonic
1168308270 19:55447944-55447966 GACAACTCCAGCAGGGGGACAGG + Intergenic
925114591 2:1367726-1367748 GTGAACTGCATCAGGTGGACTGG - Intergenic
926133423 2:10319710-10319732 GGGAGCTCCACCAAGGGGCCAGG - Intronic
932503166 2:72202835-72202857 GTGAAATCCATAAAGGGGACAGG - Intronic
935215791 2:100974411-100974433 GTAAACTCATCCACTGGGACAGG - Intronic
948603866 2:239122634-239122656 GAAAACTCCACCAGGTGGACAGG - Intronic
948797656 2:240412999-240413021 GTGCAGTCCACCCTGGGGACAGG + Intergenic
1177944680 21:27453069-27453091 GTGAACCCAACCAAGGTGACTGG + Intergenic
1178424676 21:32469830-32469852 ATGAACTCCACCACGTGGATGGG - Intronic
1181441704 22:22939359-22939381 GAGAACACCACCACAGGGGCAGG + Intergenic
1184943996 22:47788141-47788163 CTGAACTTCACCACTGGGGCAGG + Intergenic
957855375 3:85869802-85869824 GTGCCCGCCACCACGGGGCCTGG + Intronic
967297054 3:187975539-187975561 GTGAACTAAAGCAAGGGGACGGG + Intergenic
970589992 4:17551366-17551388 CTGCACTCCACCATGGTGACAGG + Intergenic
984588133 4:181586519-181586541 GGGAACTCCACCACTTGAACTGG - Intergenic
999539093 5:152552284-152552306 GTGCACTCCACCATGGGCTCTGG - Intergenic
1001009205 5:168083038-168083060 GTAGACTCCACCTCGGGGGCAGG - Intronic
1006874035 6:37279874-37279896 GTGGACTCCACCACAGGGAAAGG - Intronic
1008627235 6:53328999-53329021 GTGAACTTCACCAGGTGGGCTGG - Intronic
1018282334 6:162200200-162200222 GTTCTCTCCACCGCGGGGACTGG + Intronic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1019516297 7:1441643-1441665 CTGGACACCACCAGGGGGACAGG + Intronic
1024002337 7:45199049-45199071 GAGAGCTCCACCATGGGGATGGG - Intergenic
1029318200 7:99733678-99733700 GTGACCTCCACTAGGGGGCCAGG + Intronic
1029323108 7:99782614-99782636 GTGACCTCCACTACGGGGCCAGG + Intronic
1032322394 7:130897222-130897244 AAAAATTCCACCACGGGGACAGG + Intergenic
1033867679 7:145713031-145713053 GTGACCACCACCACTGGGACTGG + Intergenic
1037675275 8:21045616-21045638 GTGAGCTCCAGCACCCGGACTGG - Intergenic
1039289404 8:36077615-36077637 GTGAACTCCTGCACGGAGGCAGG + Intergenic
1047016500 8:120729014-120729036 GTGCACTCCAGCCTGGGGACAGG - Intronic
1049850985 8:144830027-144830049 CTGAACTCCACCACCGCCACAGG + Intronic
1052316143 9:27118073-27118095 GGGGACTCCACCCTGGGGACAGG + Intronic
1052816931 9:33109057-33109079 GTGAACTCCTGGATGGGGACTGG + Intronic
1060657067 9:125379320-125379342 GTCAATAACACCACGGGGACGGG - Intergenic
1061609164 9:131734936-131734958 GTGAACTGCTCCAAGGTGACAGG + Intronic
1192490939 X:71577230-71577252 TTGCACTCCAGCATGGGGACAGG - Intergenic
1193749581 X:85326230-85326252 GTGAACACCACCACAGAGGCCGG - Intronic