ID: 1019055766

View in Genome Browser
Species Human (GRCh38)
Location 6:169222247-169222269
Sequence GGTGAACTCCACCACGGGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 70}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019055766_1019055775 8 Left 1019055766 6:169222247-169222269 CCGTCCCCGTGGTGGAGTTCACC 0: 1
1: 0
2: 2
3: 8
4: 70
Right 1019055775 6:169222278-169222300 GGACACGCCGGAGTAGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 20
1019055766_1019055777 17 Left 1019055766 6:169222247-169222269 CCGTCCCCGTGGTGGAGTTCACC 0: 1
1: 0
2: 2
3: 8
4: 70
Right 1019055777 6:169222287-169222309 GGAGTAGCCATAGGCCCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 34
1019055766_1019055779 22 Left 1019055766 6:169222247-169222269 CCGTCCCCGTGGTGGAGTTCACC 0: 1
1: 0
2: 2
3: 8
4: 70
Right 1019055779 6:169222292-169222314 AGCCATAGGCCCGCGTGGGCTGG 0: 1
1: 1
2: 1
3: 6
4: 85
1019055766_1019055778 18 Left 1019055766 6:169222247-169222269 CCGTCCCCGTGGTGGAGTTCACC 0: 1
1: 0
2: 2
3: 8
4: 70
Right 1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1019055766_1019055772 -4 Left 1019055766 6:169222247-169222269 CCGTCCCCGTGGTGGAGTTCACC 0: 1
1: 0
2: 2
3: 8
4: 70
Right 1019055772 6:169222266-169222288 CACCACCTTGAGGGACACGCCGG 0: 1
1: 0
2: 1
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019055766 Original CRISPR GGTGAACTCCACCACGGGGA CGG (reversed) Exonic
903588886 1:24439029-24439051 GGGGGACTCCAAAACGGGGAGGG + Intronic
904968609 1:34401041-34401063 GCTGAGCTTCACCACGAGGATGG + Intergenic
909531953 1:76691925-76691947 GGAGAACACCACCAAAGGGATGG + Intergenic
919368057 1:196690691-196690713 AGTGCACTCCACCAGGGGCAGGG - Intronic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1067568830 10:47357156-47357178 GGTGAACTCCTCCGCGGTGCCGG - Exonic
1070058015 10:72953953-72953975 TGTGAACTGCAGCAGGGGGAAGG + Intronic
1073178113 10:101568901-101568923 GGTGATCTCAAACAAGGGGAGGG + Intergenic
1077062084 11:621938-621960 GGTGCACCTCACAACGGGGAGGG - Intronic
1080549070 11:33353385-33353407 GGTGAACTATGCCACTGGGATGG - Exonic
1089613000 11:119679974-119679996 TGTGAACTCCTCCAAGGGCAGGG + Intronic
1092385581 12:8033512-8033534 GGGGAACTCCCCCAAGGGGGAGG + Exonic
1092517256 12:9227504-9227526 TGAGAACACCACCAAGGGGATGG + Intergenic
1110411032 13:75204172-75204194 TGAGAACACCACCAAGGGGATGG + Intergenic
1112294692 13:98176723-98176745 GGGCAACTCCTCCTCGGGGATGG - Exonic
1120612357 14:86657939-86657961 GGTGAACTCCACCATGGGAATGG - Intergenic
1121028564 14:90636457-90636479 GTTGAAATCTACCACTGGGATGG - Intronic
1122227035 14:100285978-100286000 GGAGAGCTCCACCACGGGCGTGG + Intergenic
1124207951 15:27739268-27739290 GGTCAACTCCACCCCTAGGAAGG + Intergenic
1127861111 15:62994908-62994930 GCTGAACTCCACAAAGGGAAGGG - Intergenic
1129707761 15:77804464-77804486 GGTGAGCTCCCCATCGGGGAGGG + Intronic
1135740692 16:24972870-24972892 ACTGAACTCCTCCACAGGGAGGG + Intronic
1139793059 16:69456259-69456281 GGTGAATCCCAACACTGGGAAGG - Intronic
1142413124 16:89926169-89926191 GGCGAACCCCGCCCCGGGGAGGG - Intronic
1146050311 17:29545815-29545837 AGTGAACACCAACACTGGGAAGG - Exonic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1150655406 17:67035953-67035975 GGTGACCTCCCCCACTGGGATGG - Intergenic
1152380676 17:79940985-79941007 GGTGCACTCCACCGCGGGCATGG + Exonic
1152750771 17:82061510-82061532 TGTGAACAGCACCATGGGGAGGG + Intronic
1153522159 18:5963441-5963463 GGTGGAGGCCACCACGGGGCAGG - Intronic
1158555340 18:58470352-58470374 TCTGAAGTCCACCACTGGGAGGG + Intergenic
1160762281 19:791718-791740 GCTGAACTCCCCCGGGGGGAGGG + Intergenic
1160792117 19:927703-927725 GGTGACCTCCAGCCTGGGGATGG + Intronic
1162267076 19:9584470-9584492 GGTGGACTCCACCACGATAAAGG + Exonic
1162958708 19:14113856-14113878 GCTGAACCCCAACACTGGGATGG + Intronic
1165325169 19:35110142-35110164 GGTGAACTCATCCAGGAGGAAGG + Intergenic
1165957082 19:39507669-39507691 GGCCAACTGCACCACGGAGATGG - Intronic
924962184 2:45662-45684 GGAGAACTTCACCGCGGGGTCGG - Exonic
925596693 2:5562461-5562483 GGTGAACTCCCCCCAGTGGATGG - Intergenic
933810844 2:86031844-86031866 GGTGAGCTCCACCTCTGTGAGGG - Intronic
938414620 2:131093758-131093780 GGTGACCGCCACTACGGGGTCGG + Intergenic
941075774 2:161004994-161005016 GTTAAACTCAACAACGGGGAAGG - Intergenic
944177679 2:196850968-196850990 GTTCAACTCCAGCAAGGGGATGG + Intronic
1173020476 20:39263692-39263714 GGAGAACAGCACCAAGGGGATGG + Intergenic
1175446580 20:59024275-59024297 GGTGAGCTCGGCCACGGAGAGGG - Exonic
1175877117 20:62235605-62235627 GGTGACCTCCCCCATGGTGAGGG + Intronic
1178320975 21:31605434-31605456 GGAGAACAGCACCAAGGGGATGG - Intergenic
1178424677 21:32469831-32469853 GATGAACTCCACCACGTGGATGG - Intronic
1179979874 21:44890301-44890323 GGTGTTCTCCACCAAGGGCAAGG - Intronic
949300485 3:2577880-2577902 GGTAAACTGCACCACAGAGATGG - Intronic
950151328 3:10689749-10689771 GCTGTACTCCAGCACGTGGAGGG + Intronic
950799814 3:15541275-15541297 TGTGAACAGCACCAAGGGGATGG + Intergenic
952946225 3:38479348-38479370 GGTGGACACCTCCACAGGGAAGG - Intronic
954710880 3:52504556-52504578 GGCCAGCTCCACCATGGGGAGGG - Intronic
958533388 3:95364737-95364759 GGTGAATTGCACCTCGGGGATGG - Intergenic
964176737 3:153832617-153832639 GGAGAACAGCACCAAGGGGATGG + Intergenic
967436885 3:189457546-189457568 GGTCAACTCCACCGCAGAGAGGG + Intergenic
968883915 4:3317306-3317328 GATGAACTGCAGGACGGGGAGGG - Exonic
971545730 4:27883067-27883089 GGTGAACTGCTCCACGCAGAAGG + Intergenic
977141410 4:93376812-93376834 TCTGCACTCCACCCCGGGGAAGG - Intronic
982915359 4:161202508-161202530 GGTGAACTCAAACATGGGGTAGG - Intergenic
986561031 5:9061070-9061092 GGTGAAATCCACCAAGGGGCTGG + Intronic
998442461 5:142173921-142173943 GGAGAACAGCACCAAGGGGATGG + Intergenic
999168709 5:149574489-149574511 GGTGAACACAACCAAGGGGCAGG - Intronic
1002154564 5:177266256-177266278 GGTGACCATCACCAAGGGGAAGG - Intronic
1004165740 6:13255248-13255270 GGAGAACAACACCAAGGGGAAGG + Intronic
1009228424 6:61037776-61037798 GGGGAACTATATCACGGGGAGGG + Intergenic
1012230724 6:96758270-96758292 GGAGAACAGCACCAAGGGGATGG - Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1024002338 7:45199050-45199072 GGAGAGCTCCACCATGGGGATGG - Intergenic
1027735312 7:81925273-81925295 GCTGAACTCTAGCACGGGGACGG - Intergenic
1029570717 7:101366995-101367017 AGTTAACTACACCACTGGGAAGG - Intronic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1039924739 8:41919213-41919235 GGTAAACACCACCACAGGGATGG - Intergenic
1053397658 9:37788777-37788799 AGTGAACTCCCCCAAGGGCAGGG - Intronic
1057961494 9:99461749-99461771 TGAGAACACCACCAAGGGGACGG - Intergenic
1060657068 9:125379321-125379343 GGTCAATAACACCACGGGGACGG - Intergenic
1061400981 9:130368275-130368297 GGTCAACCCCTCCCCGGGGAGGG + Intronic
1187281602 X:17861444-17861466 GGTGATCTCGCCCACGGGGAGGG + Intergenic
1190746863 X:53329057-53329079 AGTGAACTCCACCACGGCCCTGG - Intergenic
1196456084 X:115892677-115892699 GTAGAACTCCAGCACTGGGAAGG + Intergenic