ID: 1019055767

View in Genome Browser
Species Human (GRCh38)
Location 6:169222251-169222273
Sequence AGGTGGTGAACTCCACCACG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019055767_1019055775 4 Left 1019055767 6:169222251-169222273 CCCCGTGGTGGAGTTCACCACCT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1019055775 6:169222278-169222300 GGACACGCCGGAGTAGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 20
1019055767_1019055778 14 Left 1019055767 6:169222251-169222273 CCCCGTGGTGGAGTTCACCACCT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1019055767_1019055772 -8 Left 1019055767 6:169222251-169222273 CCCCGTGGTGGAGTTCACCACCT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1019055772 6:169222266-169222288 CACCACCTTGAGGGACACGCCGG 0: 1
1: 0
2: 1
3: 9
4: 105
1019055767_1019055779 18 Left 1019055767 6:169222251-169222273 CCCCGTGGTGGAGTTCACCACCT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1019055779 6:169222292-169222314 AGCCATAGGCCCGCGTGGGCTGG 0: 1
1: 1
2: 1
3: 6
4: 85
1019055767_1019055777 13 Left 1019055767 6:169222251-169222273 CCCCGTGGTGGAGTTCACCACCT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1019055777 6:169222287-169222309 GGAGTAGCCATAGGCCCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019055767 Original CRISPR AGGTGGTGAACTCCACCACG GGG (reversed) Exonic
900581491 1:3412011-3412033 AGGACGTCAACACCACCACGGGG + Exonic
904396448 1:30225417-30225439 AGGAGGTGGACTGCAGCACGAGG - Intergenic
904567557 1:31436802-31436824 AGGTGGTGACCTCCACACTGGGG - Intergenic
906500787 1:46340741-46340763 AGGTGGTGAGCGCCACCCGGCGG - Exonic
906567795 1:46813165-46813187 AGGTGGTGAGCTCCCCCGCATGG - Intronic
911663730 1:100531787-100531809 AGGTGGTGCAGGCCATCACGTGG + Intergenic
914324154 1:146595170-146595192 AGGTAGTGACCTCCTCCAAGTGG + Intergenic
916954692 1:169819920-169819942 AGCTGCTGAACTCCAGCACTAGG + Intronic
918249555 1:182689730-182689752 AGCTGCTGAACTCCACCATATGG + Intergenic
920188759 1:204179138-204179160 AGGCGGTGAACTCCCCTACCTGG + Intergenic
921456712 1:215380307-215380329 AGGTGATGAATGCCACCAGGTGG - Intergenic
922915272 1:229252330-229252352 AGGGAGTGAACCCCAACACGAGG + Intergenic
1067784664 10:49236770-49236792 AGGTGGTGAAGTCCAGTAGGTGG + Intergenic
1070863828 10:79694015-79694037 AGGTGGACACCTCCATCACGTGG + Intergenic
1084030264 11:66476777-66476799 AGACTGTGAACTCCACCAGGGGG - Exonic
1085265623 11:75236368-75236390 ACGTGATGAACTCAGCCACGAGG - Intergenic
1091906082 12:4190095-4190117 GGGTGGTGAAATCCTCCACACGG - Intergenic
1092615353 12:10211723-10211745 AGGTGGGGAAATCCAGAACGAGG + Intergenic
1093326161 12:17777374-17777396 AGCTGGTGATGTCCACTACGTGG - Intergenic
1104730628 12:131103555-131103577 AGGTAGTGCACTGGACCACGGGG - Intronic
1105837347 13:24223213-24223235 TGGTGGGGAACTCCTCCACATGG + Exonic
1113078978 13:106496607-106496629 AGTTGGTGAACACCAGCAAGTGG - Intronic
1113531989 13:111033917-111033939 AGGAGGCGGGCTCCACCACGTGG + Intergenic
1121254010 14:92518486-92518508 AGCTGGTGACCCCCACCACAAGG + Intronic
1125431027 15:39593592-39593614 AAGTTGTAAACTCCACCACAGGG + Exonic
1127455514 15:59152930-59152952 AGTTGGTGAACTCTGCCAGGAGG - Intronic
1131304756 15:91232213-91232235 TGATGGTGAAATCCACCACTGGG + Intronic
1138527958 16:57619860-57619882 AGGTGCTGAAGTCCACGAAGAGG + Intronic
1140009405 16:71115675-71115697 AGGTAGTGACCTCCTCCAAGTGG - Exonic
1140944133 16:79751802-79751824 AGGTGGTGAACTGCAGTACCAGG + Intergenic
1143619577 17:8073303-8073325 AGGCGGTGAACTCCATCTGGAGG + Exonic
1150189847 17:63226775-63226797 AGGAGGGGAACACCACCACTGGG - Intronic
1151905901 17:77048958-77048980 ACGTGCTAAACCCCACCACGGGG - Intergenic
1153549674 18:6248562-6248584 AGTTGGTGACCTCCACGAGGTGG - Intronic
1161015228 19:1979909-1979931 AGGCGTTGAACTCCACCAACGGG + Exonic
926424806 2:12731185-12731207 AGGTGATGACCTCCTGCACGAGG + Intronic
927997047 2:27494081-27494103 GGGAGGTGAACACCACCACCCGG - Exonic
930219338 2:48729744-48729766 AGGTGGTCAACTCCTGCACATGG + Intronic
940756274 2:157686661-157686683 AGGTGGTGAAAGGTACCACGAGG + Intergenic
946339217 2:219057544-219057566 ATGTGGTGATGTCCACCGCGCGG + Exonic
1171037360 20:21726372-21726394 AGGTGGTGCAGGCCATCACGTGG + Intergenic
1171847576 20:30286366-30286388 AGGTGGTGGGCTCCCCCAGGCGG - Intergenic
1176146398 20:63567413-63567435 AGGTGGTGGTGACCACCACGCGG + Exonic
1178424678 21:32469835-32469857 AGCAGATGAACTCCACCACGTGG - Intronic
1180059987 21:45379785-45379807 AGGTGGTGAATGCTATCACGGGG + Intergenic
1183256064 22:36763134-36763156 AGGTGGTGAGCCCCCCCACAGGG + Intronic
1184019780 22:41813271-41813293 AGGCCGTGTTCTCCACCACGTGG - Exonic
1184943994 22:47788136-47788158 AGGAGCTGAACTTCACCACTGGG + Intergenic
950151326 3:10689745-10689767 AGATGCTGTACTCCAGCACGTGG + Intronic
951093034 3:18597720-18597742 AGCTGGTGAAAGCCACCAGGAGG - Intergenic
961087342 3:124079533-124079555 AGGTGGTATACTCTACCACCAGG - Intergenic
988527914 5:32002465-32002487 AGCTGGTGAATTCCACAAGGAGG + Intronic
989191301 5:38672223-38672245 TGGTGGTGAAATCCCCCACAAGG + Intergenic
994119827 5:96101483-96101505 ATGTGGTGAACTCCTCTATGTGG - Intergenic
994394343 5:99215896-99215918 AGGTGGTGTACACCACCCCTGGG - Intergenic
1003968967 6:11280303-11280325 AGGTTGTTCACTCCACCACTTGG + Intronic
1004396423 6:15249198-15249220 AGGTGGCCAAATCCACAACGCGG - Intronic
1006874036 6:37279879-37279901 AAGTTGTGGACTCCACCACAGGG - Intronic
1007594776 6:43044758-43044780 AGGTGATGTTCTGCACCACGGGG + Exonic
1010781279 6:79947820-79947842 AGGCGGTGAACTCCTCCGCAGGG - Intergenic
1013659172 6:112277288-112277310 AGCTGGTGTACACCACCACGCGG + Intergenic
1016548023 6:145246144-145246166 AATGGGTGAACTCCACCACTGGG - Intergenic
1019055767 6:169222251-169222273 AGGTGGTGAACTCCACCACGGGG - Exonic
1019747452 7:2708816-2708838 AGGTGTTGACTTCCACCAGGAGG - Intronic
1021309794 7:19079973-19079995 AAGTGGTGAAGTCCACAACGGGG - Intronic
1029730237 7:102433796-102433818 GGTTGGTGACCTCCACCCCGCGG + Intronic
1044631848 8:94287905-94287927 AGGTGGTGAACAACATCAGGTGG + Intergenic
1050382112 9:5041818-5041840 AGGCGCTGAACTCCACCAATGGG + Intronic
1053478113 9:38396446-38396468 GGGTGGTGAACATCATCACGGGG + Exonic
1059460045 9:114423886-114423908 AGGTGGTGAAATCCACTGGGAGG - Intronic
1060391329 9:123279759-123279781 AGGTGGTGAAGGGCATCACGTGG - Intergenic