ID: 1019055768

View in Genome Browser
Species Human (GRCh38)
Location 6:169222252-169222274
Sequence AAGGTGGTGAACTCCACCAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019055768_1019055777 12 Left 1019055768 6:169222252-169222274 CCCGTGGTGGAGTTCACCACCTT 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1019055777 6:169222287-169222309 GGAGTAGCCATAGGCCCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 34
1019055768_1019055778 13 Left 1019055768 6:169222252-169222274 CCCGTGGTGGAGTTCACCACCTT 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1019055768_1019055779 17 Left 1019055768 6:169222252-169222274 CCCGTGGTGGAGTTCACCACCTT 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1019055779 6:169222292-169222314 AGCCATAGGCCCGCGTGGGCTGG 0: 1
1: 1
2: 1
3: 6
4: 85
1019055768_1019055772 -9 Left 1019055768 6:169222252-169222274 CCCGTGGTGGAGTTCACCACCTT 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1019055772 6:169222266-169222288 CACCACCTTGAGGGACACGCCGG 0: 1
1: 0
2: 1
3: 9
4: 105
1019055768_1019055783 30 Left 1019055768 6:169222252-169222274 CCCGTGGTGGAGTTCACCACCTT 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1019055783 6:169222305-169222327 CGTGGGCTGGTCCTCCCAGTAGG 0: 1
1: 0
2: 2
3: 10
4: 110
1019055768_1019055775 3 Left 1019055768 6:169222252-169222274 CCCGTGGTGGAGTTCACCACCTT 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1019055775 6:169222278-169222300 GGACACGCCGGAGTAGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019055768 Original CRISPR AAGGTGGTGAACTCCACCAC GGG (reversed) Exonic
904567558 1:31436803-31436825 AAGGTGGTGACCTCCACACTGGG - Intergenic
905780711 1:40706772-40706794 AAGGTGCTGAAGTCTACCAGTGG - Intronic
906914492 1:49994285-49994307 AATGTGTTGAACTACACCATGGG + Intronic
909896097 1:81070974-81070996 AAATTAGTTAACTCCACCACTGG - Intergenic
912144346 1:106773575-106773597 CAGGAGGTGATGTCCACCACTGG - Intergenic
913065472 1:115249083-115249105 AATGTGTTGAACTCCACTATGGG + Intergenic
914916449 1:151822267-151822289 AAGGTGGTGGGTGCCACCACAGG + Intronic
915126702 1:153670629-153670651 AAGGTGGGGAGCTCCTCCAGGGG + Intronic
915604094 1:156939994-156940016 AAGGTGGTGACCTCAGGCACAGG + Intronic
915619922 1:157074831-157074853 CAGGTAGTAAACTCCCCCACAGG - Intergenic
916455313 1:164965181-164965203 AATGTGGAGAACTCTGCCACTGG + Intergenic
923491625 1:234489221-234489243 AAGGAGGTGAAATCCATTACCGG + Intergenic
1063689790 10:8275951-8275973 AACCTGGTGCTCTCCACCACAGG - Intergenic
1063820085 10:9824866-9824888 AATCTGGTGCTCTCCACCACAGG - Intergenic
1065587374 10:27232842-27232864 AAGGAGTTTAACTCCACCAAAGG + Intronic
1068140702 10:53003124-53003146 AAGGTCTTGGACTCCTCCACTGG + Intergenic
1072843109 10:98796622-98796644 AAGCTGGTTAGCTTCACCACTGG + Intronic
1073423779 10:103443916-103443938 AAGCTGGTGAACTCTACAACCGG + Exonic
1074711183 10:116178921-116178943 AAGCAGGTGCTCTCCACCACAGG - Intronic
1075567708 10:123516563-123516585 AAGGTGCTGCACTCAGCCACTGG + Intergenic
1076255810 10:129023999-129024021 ATGGTTGTGGACTCCACCAAAGG + Intergenic
1078085909 11:8232935-8232957 AGGGTTGTAAACTCCAGCACTGG + Intronic
1081890224 11:46535041-46535063 AAGTTTGTTAATTCCACCACAGG + Intronic
1084657075 11:70525887-70525909 AAGGTGGAGAAGTCCAGCAGAGG - Intronic
1085648748 11:78247306-78247328 ATGGTGGTGGAAGCCACCACAGG - Intronic
1089394037 11:118123455-118123477 AAGGTGGGACATTCCACCACAGG + Intergenic
1089689217 11:120176497-120176519 AGGGTGGTCATCTCCACCGCTGG + Intronic
1091453475 12:587835-587857 AAGCTGGTTATTTCCACCACAGG + Intronic
1096293285 12:50360874-50360896 ATGTTGATGAACACCACCACTGG - Exonic
1100707008 12:97211779-97211801 AAGGTCTTGAAATCCACCAAGGG - Intergenic
1102725908 12:115064387-115064409 AATGTGGTGATCATCACCACTGG - Intergenic
1106414301 13:29533521-29533543 AAGGGGCTGAACTCCATCTCAGG + Intronic
1106490381 13:30216273-30216295 AAGGTGGTGACCCCCAGCAGAGG + Intronic
1108418082 13:50221336-50221358 AAGGTGATGTACTCCACAAGTGG + Intronic
1112286086 13:98105614-98105636 AATCTGGTGCACTCCACCAAGGG + Intergenic
1113580691 13:111426534-111426556 AAGGTGGTGGAATCCACCACAGG + Intergenic
1113990530 14:16024288-16024310 TAGGTGGAGACCTCCACCCCGGG - Intergenic
1115924825 14:38420253-38420275 AAGGTTGTGAAATCAATCACTGG + Intergenic
1116538285 14:46063964-46063986 AATCCGGTGCACTCCACCACCGG - Intergenic
1117092596 14:52266204-52266226 ATAGTTCTGAACTCCACCACTGG - Intergenic
1118022511 14:61732881-61732903 AAGGTGGTGAACATCACCTTTGG + Intronic
1119700870 14:76753639-76753661 AAGTTGATGCACTCAACCACAGG + Intergenic
1120702106 14:87709421-87709443 AAGGTCGTGGAAGCCACCACAGG + Intergenic
1121321472 14:92994117-92994139 AGGGTGGTGCATTCCAGCACTGG + Intronic
1125431026 15:39593591-39593613 AAAGTTGTAAACTCCACCACAGG + Exonic
1125886154 15:43231044-43231066 AGAGTGGTGAGATCCACCACTGG - Intergenic
1127431139 15:58909778-58909800 AATATGTTGAACACCACCACAGG + Intronic
1127816776 15:62617567-62617589 AGGGTGGTGACCACCAACACAGG - Intronic
1131304755 15:91232212-91232234 ATGATGGTGAAATCCACCACTGG + Intronic
1132027816 15:98417873-98417895 ATGGTGGAGAACTGGACCACAGG - Intergenic
1133962738 16:10508916-10508938 AAGGTGGTCAACTCTAGCACAGG - Intergenic
1134134794 16:11671147-11671169 AAGGAGGTCAACTGCAGCACAGG - Intronic
1134379266 16:13709129-13709151 AAGGGGGTGAACTACAGCAAGGG + Intergenic
1136604702 16:31325458-31325480 AAGGCGGTGATATCCACCTCCGG - Intronic
1143540256 17:7564183-7564205 AAGATGATGTACTCCACTACTGG - Intronic
1146288647 17:31592557-31592579 AACATGTTGAACTACACCACAGG + Intergenic
1150018771 17:61589001-61589023 AAGCTGGGTAACTCCACCAGAGG - Intergenic
1150189848 17:63226776-63226798 AAGGAGGGGAACACCACCACTGG - Intronic
1150655408 17:67035958-67035980 AGGGAGGTGACCTCCCCCACTGG - Intergenic
1153914772 18:9735479-9735501 CAGGTGGTGTGCACCACCACAGG - Intronic
1161015227 19:1979908-1979930 CAGGCGTTGAACTCCACCAACGG + Exonic
1164187182 19:22880591-22880613 AAGCTGATGACCTCCACCTCTGG - Intergenic
1167421279 19:49404913-49404935 AAAGTGGTGAACATAACCACAGG + Intronic
1167427428 19:49436694-49436716 AAGCAGGTGCAGTCCACCACCGG + Exonic
925600895 2:5607802-5607824 AAAGTGGTGAAGTCCATGACAGG - Intergenic
928034260 2:27807017-27807039 AAGCTAGGGAACTCCACCATTGG + Intronic
928399084 2:30965125-30965147 AGGATGCTGAACACCACCACTGG + Intronic
930130928 2:47849788-47849810 AAGGTGCTCATCTCCAGCACAGG + Intronic
935812191 2:106809242-106809264 AAGGGGGTGGACTTCATCACGGG + Intronic
936600377 2:113889810-113889832 AAGTTGGTGAAATCCACTGCGGG - Intergenic
936885120 2:117300610-117300632 AAGGTGGTGAGTTCCCCCAGGGG - Intergenic
937087339 2:119180082-119180104 GAGGTTGGGAACTCCACCACTGG - Intergenic
940342275 2:152593965-152593987 AAGGAGGAAAACTCCCCCACAGG + Intronic
1169059391 20:2650378-2650400 AAGATGGTCTACTCCACCACAGG + Intergenic
1174651364 20:52128657-52128679 GAGTTGCTGCACTCCACCACTGG + Intronic
1180316740 22:11283238-11283260 TAGGTGGAGACCTCCACCCCGGG + Intergenic
1183256063 22:36763133-36763155 GAGGTGGTGAGCCCCCCCACAGG + Intronic
1184943993 22:47788135-47788157 TAGGAGCTGAACTTCACCACTGG + Intergenic
950959959 3:17094865-17094887 AAGAGGGTGAACTCGACCAGAGG + Intergenic
956331967 3:68120619-68120641 AAGTTTGTGAACCTCACCACAGG - Intronic
967995874 3:195166040-195166062 AAGGTGGGGAAGTCCAGGACTGG + Intronic
973093925 4:46173642-46173664 AAAGTTGTGAACTCTACAACAGG - Intergenic
978672526 4:111267614-111267636 TAGGTGGAGAACTCAAACACTGG + Intergenic
984084034 4:175286155-175286177 AAGGTGGTAAACCCCACTGCAGG + Intergenic
991146831 5:63316881-63316903 AAGGTGGTGAACTGTGTCACAGG - Intergenic
991655677 5:68901856-68901878 AAGGTGGTGGACTCCACCCTAGG - Intergenic
994394344 5:99215897-99215919 TAGGTGGTGTACACCACCCCTGG - Intergenic
997760880 5:136446338-136446360 CAGGTGGAGAACTATACCACCGG - Intergenic
999425960 5:151488072-151488094 AAGGTGGTGACCTCCAGGAGCGG - Exonic
1006146754 6:31963967-31963989 GAGAAGGTGAACACCACCACGGG - Exonic
1006874037 6:37279880-37279902 GAAGTTGTGGACTCCACCACAGG - Intronic
1007989379 6:46239417-46239439 AAAGTGGTGAACTCCAATCCAGG + Intronic
1009025867 6:57999755-57999777 AAGATGGTGCATTCTACCACAGG + Intergenic
1009201425 6:60751222-60751244 AAGATGGTGCATTCTACCACAGG + Intergenic
1009244451 6:61218621-61218643 AAAGTGATGGACTCCAGCACTGG + Intergenic
1010781280 6:79947821-79947843 GAGGCGGTGAACTCCTCCGCAGG - Intergenic
1016548024 6:145246145-145246167 CAATGGGTGAACTCCACCACTGG - Intergenic
1019055768 6:169222252-169222274 AAGGTGGTGAACTCCACCACGGG - Exonic
1019064311 6:169283410-169283432 AAGGTGGTGATGTCCTCCACAGG + Intergenic
1019791122 7:3014599-3014621 ACGGTGCTGAGCTCCACCGCTGG - Intronic
1021309795 7:19079974-19079996 CAAGTGGTGAAGTCCACAACGGG - Intronic
1029859147 7:103550824-103550846 AAGGATGTGAACCCCACTACAGG + Intronic
1030016763 7:105230373-105230395 AAGGTGGTGGACACCGACACTGG + Intronic
1030798950 7:113825752-113825774 AAGAGTGTGAACTTCACCACTGG - Intergenic
1031725545 7:125233516-125233538 AATGTGGTGGATTCTACCACTGG + Intergenic
1032241216 7:130160762-130160784 AAGGTGGTGATCAGCTCCACTGG - Intergenic
1034551560 7:151823778-151823800 AAGGAGGTAAAGTCCACCCCTGG + Intronic
1036426355 8:8648490-8648512 AAGTTGGAAAATTCCACCACTGG - Intergenic
1037340944 8:17844277-17844299 AAGGTGGAGAACTGGCCCACAGG - Intergenic
1038510822 8:28133765-28133787 AAGCTGGTGAACTGCACCTGAGG + Intronic
1038574106 8:28689140-28689162 AAGGGGCTGAGCTCCACAACTGG - Intronic
1042112897 8:65400044-65400066 AACGTGGTGAAATGCATCACGGG - Intergenic
1044726723 8:95200454-95200476 AGTGTGGTGTACTCCACAACAGG - Intergenic
1046918101 8:119698962-119698984 AAAGTGGTGAACTACAACAGAGG + Intergenic
1048515891 8:135111335-135111357 AAGGCCATGAACTCCACAACAGG - Intergenic
1048831496 8:138481960-138481982 CAGATGGTGAACTCCTCCAGGGG - Intronic
1050382111 9:5041817-5041839 CAGGCGCTGAACTCCACCAATGG + Intronic
1057227067 9:93298046-93298068 AAGGTCGTGGCCTCCAGCACAGG + Exonic
1058570682 9:106339727-106339749 TAGTTGGTCAACTTCACCACAGG - Intergenic
1060223627 9:121777130-121777152 AAGGAAGTAAACTCCACGACTGG - Intronic
1191253123 X:58268650-58268672 AAGCTGGTGTACTCCCCCTCAGG - Intergenic
1192723425 X:73724109-73724131 AAGGTGGTGCTCTCCATCCCAGG + Intergenic
1195539423 X:106045692-106045714 AAGGTGCTGACCTCAACCAAAGG - Intergenic
1199404538 X:147441884-147441906 AACCTGGTGTTCTCCACCACTGG + Intergenic