ID: 1019055769

View in Genome Browser
Species Human (GRCh38)
Location 6:169222253-169222275
Sequence CAAGGTGGTGAACTCCACCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019055769_1019055783 29 Left 1019055769 6:169222253-169222275 CCGTGGTGGAGTTCACCACCTTG 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1019055783 6:169222305-169222327 CGTGGGCTGGTCCTCCCAGTAGG 0: 1
1: 0
2: 2
3: 10
4: 110
1019055769_1019055777 11 Left 1019055769 6:169222253-169222275 CCGTGGTGGAGTTCACCACCTTG 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1019055777 6:169222287-169222309 GGAGTAGCCATAGGCCCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 34
1019055769_1019055775 2 Left 1019055769 6:169222253-169222275 CCGTGGTGGAGTTCACCACCTTG 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1019055775 6:169222278-169222300 GGACACGCCGGAGTAGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 20
1019055769_1019055778 12 Left 1019055769 6:169222253-169222275 CCGTGGTGGAGTTCACCACCTTG 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1019055769_1019055779 16 Left 1019055769 6:169222253-169222275 CCGTGGTGGAGTTCACCACCTTG 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1019055779 6:169222292-169222314 AGCCATAGGCCCGCGTGGGCTGG 0: 1
1: 1
2: 1
3: 6
4: 85
1019055769_1019055772 -10 Left 1019055769 6:169222253-169222275 CCGTGGTGGAGTTCACCACCTTG 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1019055772 6:169222266-169222288 CACCACCTTGAGGGACACGCCGG 0: 1
1: 0
2: 1
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019055769 Original CRISPR CAAGGTGGTGAACTCCACCA CGG (reversed) Exonic
900474393 1:2869426-2869448 CAAGGTGGTCAGCTCCCCGAGGG + Intergenic
902215650 1:14932755-14932777 CAGGGTTCTGAACTCCACCCTGG - Intronic
903460528 1:23517492-23517514 CTAAGTCGTGAACTCCTCCAAGG + Intronic
904567559 1:31436804-31436826 AAAGGTGGTGACCTCCACACTGG - Intergenic
906914491 1:49994284-49994306 CAATGTGTTGAACTACACCATGG + Intronic
907580915 1:55571916-55571938 CAAGGAGGAGAAATGCACCATGG - Intergenic
912269920 1:108198864-108198886 CATGGTGGGGAACTCCAACTGGG + Intronic
913065471 1:115249082-115249104 GAATGTGTTGAACTCCACTATGG + Intergenic
913212000 1:116589752-116589774 CTAGATGGTGAGCTCCCCCAGGG + Intronic
913559273 1:120001417-120001439 AAAGGTGGTGAACTCTGCCTGGG - Intronic
913638591 1:120789125-120789147 AAAGGTGGTGAACTCTGCCTGGG + Intergenic
914279867 1:146160860-146160882 AAAGGTGGTGAACTCTGCCTGGG - Intronic
914540905 1:148611778-148611800 AAAGGTGGTGAACTCTGCCTGGG - Intronic
914625735 1:149459468-149459490 AAAGGTGGTGAACTCTGCCTGGG + Intergenic
915107070 1:153541292-153541314 AGTGGTGGTGACCTCCACCAAGG - Intronic
915126701 1:153670628-153670650 AAAGGTGGGGAGCTCCTCCAGGG + Intronic
915515097 1:156408092-156408114 TTAGGTGGTGAACTCCACAACGG - Intronic
918042112 1:180919724-180919746 CAAGGAGGAGACCTCAACCATGG + Intronic
919688639 1:200508373-200508395 CTAGACTGTGAACTCCACCAGGG - Intergenic
920208794 1:204313274-204313296 TAAGATGGTGAACTCCAACAGGG - Intronic
920602590 1:207344409-207344431 CATGGTGATGAATTCCATCATGG + Intronic
921577385 1:216852319-216852341 CAAGATGGTGAACACAACCAAGG + Intronic
924636326 1:245791055-245791077 CTGGGTGGTGAGCTTCACCATGG - Intronic
1064243126 10:13648452-13648474 CCTGGTGGTGCTCTCCACCATGG + Intronic
1068237855 10:54262479-54262501 CAGGGTGGTGAACTTCTCCCAGG - Intronic
1070253717 10:74796065-74796087 AAAGGTGCTGAACTTCACCAGGG - Intergenic
1070975285 10:80601591-80601613 CTAGGCTGTGAACTCCACGAGGG - Intronic
1071215198 10:83393231-83393253 CAGGGTGGTGAGTTCCCCCAAGG + Intergenic
1074548786 10:114423917-114423939 CAATATGGTGAACTCCAGAAAGG - Intergenic
1077316747 11:1922697-1922719 CAAGGAGGTGGACTCACCCAAGG + Intronic
1078604876 11:12766295-12766317 CAAATTGGTTAAATCCACCAGGG - Intronic
1078784791 11:14478526-14478548 CAAGGTGTTGAACTGAACAATGG + Intronic
1079875280 11:25848650-25848672 CAAGGTGGAGAAATCCCCCTGGG + Intergenic
1080679321 11:34459416-34459438 CAAAGTGGTGAGCCACACCATGG + Intronic
1084030266 11:66476779-66476801 CTAGACTGTGAACTCCACCAGGG - Exonic
1084302764 11:68262109-68262131 CACAGTGGTGACCACCACCAAGG - Exonic
1084920422 11:72465051-72465073 GAAGGTGGAGGACTCCAACAGGG - Intergenic
1085193148 11:74646785-74646807 CAAAGTGGAGAACACCACCCTGG - Intronic
1089443378 11:118533489-118533511 CAAGGTGCTGAACCCCACGAGGG - Exonic
1091785885 12:3243207-3243229 CGAGATGGGGAACTCAACCACGG - Intronic
1092085665 12:5757082-5757104 CTAGGTCTTGAGCTCCACCAGGG + Intronic
1095318886 12:40801178-40801200 CTAGATGGTCAACTCCATCACGG + Intronic
1095827994 12:46550265-46550287 AAAGGTGTTGAAATCCATCAGGG - Intergenic
1095919507 12:47515399-47515421 AAAGGTGGTTAACTCCTCCAAGG - Intergenic
1096211549 12:49769984-49770006 CAATGTGGAGAACTCTACCAGGG - Intergenic
1096650925 12:53061627-53061649 CAAGGCGGTGAGATCCAACATGG + Intronic
1097951004 12:65428191-65428213 CCATGTGGTGAAAACCACCATGG - Intronic
1100191052 12:92192052-92192074 CAAGGTTATGAACTCCATGAGGG + Intergenic
1100707009 12:97211780-97211802 GAAGGTCTTGAAATCCACCAAGG - Intergenic
1100904986 12:99286963-99286985 CAGGGTGGTGAGCTCCCCCCTGG - Intronic
1104009253 12:124917516-124917538 CAAGGTGGTGAATTTCAGAAGGG - Intergenic
1104636658 12:130441855-130441877 CAACGTGGAGAACTCCACAAAGG + Exonic
1105215245 13:18280378-18280400 CTAGATGGTGAGCTCCCCCAGGG + Intergenic
1112286085 13:98105613-98105635 AAATCTGGTGCACTCCACCAAGG + Intergenic
1114709210 14:24761121-24761143 CCAAATGGTGAACTCCACCTAGG + Intergenic
1115152634 14:30302919-30302941 CAAGGTCCTGAGCTCTACCAGGG - Intergenic
1118431751 14:65726418-65726440 CAAGATTGTGAGCCCCACCAGGG - Intronic
1120982358 14:90301278-90301300 GAAGAAGGTGAAGTCCACCATGG + Exonic
1122205942 14:100148002-100148024 CAAGGCGGTGCTCTGCACCAGGG - Intronic
1122477198 14:102018588-102018610 CATGGTGTAGAACTCCACCATGG - Exonic
1127828426 15:62727122-62727144 CAAGGCGGTGGGCTCCTCCATGG + Exonic
1132244266 15:100281781-100281803 CAAGGTGGATAACTGGACCAAGG + Intronic
1134379265 16:13709128-13709150 AAAGGGGGTGAACTACAGCAAGG + Intergenic
1134669514 16:16044459-16044481 GAAGGTTGTGTACTCCTCCAAGG + Exonic
1135947719 16:26879548-26879570 CCAGGTGGTCTACTCCACTAAGG + Intergenic
1138111619 16:54328849-54328871 CAAGTGAGTGAGCTCCACCAAGG - Intergenic
1138330976 16:56215000-56215022 CAGTGTGGTGCACTACACCATGG - Intronic
1139242705 16:65410483-65410505 CTAGGCTGTGAACTCTACCAGGG + Intergenic
1139710819 16:68774572-68774594 CAACGTGGTGCACTCCATCCTGG + Intronic
1142984545 17:3688057-3688079 CAGGGTGCGGAACTCCACCCCGG + Exonic
1145809525 17:27756151-27756173 CAAGGGGGTGAAGTCGGCCAGGG + Intergenic
1145928677 17:28667827-28667849 CAAGACTGTGAACTCCACCGGGG + Intronic
1147171603 17:38623125-38623147 CATGGTGCTGCACTCCAGCATGG + Intergenic
1149126510 17:53241035-53241057 CAACATGGTGAAATCCAACAGGG + Intergenic
1152233030 17:79124543-79124565 GAAGGTGGTGAGCTCCATAAAGG + Intronic
1152360601 17:79831543-79831565 CAGGGTGGGGGACACCACCAAGG + Intergenic
1156533351 18:37839331-37839353 CAAGGCTGTCAACTCGACCAAGG - Intergenic
1157748921 18:50161074-50161096 CCAGGTTGTGAGCTCCACAAGGG - Intronic
1160238830 18:77107612-77107634 CAAGGTGCTGAACTGCTCCTTGG + Intronic
1160429191 18:78799964-78799986 CAAGGTCGGAAACTCCACCCGGG + Intergenic
1161484736 19:4529235-4529257 CCAGGTGGTGACCTCAGCCAAGG - Exonic
1161951187 19:7469055-7469077 CAAGCTGGCGGCCTCCACCAAGG + Exonic
1162051954 19:8039702-8039724 CAAAGTGCTGTAATCCACCATGG + Intronic
1163360147 19:16840801-16840823 CTAGATGGCGAACTCCACGAGGG - Intronic
1166341945 19:42143306-42143328 CAAGCTGCTGCACTCCACCCTGG + Intronic
925972068 2:9112897-9112919 CGAGGTGGTGACCTCCAAAAGGG - Intergenic
926630643 2:15133195-15133217 CAAGGCTGTGAACTTCCCCAGGG - Intergenic
928118240 2:28563449-28563471 CATGGTGTAGAACTCCTCCAAGG + Intronic
930279627 2:49354736-49354758 GATGGTGGTGAACTATACCATGG + Intergenic
931572341 2:63681597-63681619 CAAGGTGGTGAGTTGCCCCAGGG - Intronic
934299075 2:91766359-91766381 CTAGATGGTGAGCTCCCCCAGGG - Intergenic
934893118 2:98087686-98087708 CAAGGTGATGAAGTCCACCTGGG + Intronic
935616085 2:105083338-105083360 CAAGGCTGTAAACCCCACCAGGG + Intronic
936885121 2:117300611-117300633 CAAGGTGGTGAGTTCCCCCAGGG - Intergenic
937622081 2:124000212-124000234 CAAGGAGGTGAACACCAGAAAGG - Intergenic
941158034 2:162002584-162002606 CAGGGTGGTGAAATCCTCTAAGG + Intronic
943050268 2:182905418-182905440 AAATGTGGTCACCTCCACCAGGG + Intergenic
943367812 2:186982262-186982284 CTAGGTGGCTAACTCCACCTGGG - Intergenic
1170165406 20:13356821-13356843 CAAGGTGGTGCTCTCCCTCATGG + Intergenic
1174376963 20:50132667-50132689 CAAGGAGGTTGGCTCCACCATGG + Intronic
1175762484 20:61571067-61571089 CAAGGTGGTGGGGTCCAACAGGG + Intronic
1176735427 21:10541867-10541889 GAGGGTGGTGAACACCTCCAAGG - Intronic
1179466324 21:41576583-41576605 CAAGGTCATGAACTCCAGGATGG + Intergenic
1181487565 22:23241287-23241309 CAGGGTGGTGACCGCCAGCAGGG + Intronic
949336673 3:2982419-2982441 CAAGGTGTTGACTTCCACCGTGG + Intronic
949439464 3:4065018-4065040 GAGGGTGGAGAACTGCACCATGG - Intronic
949928089 3:9057874-9057896 CAGGCTGGTGCATTCCACCAGGG - Intronic
953500818 3:43432094-43432116 CAAAATGGTCAACTCCAGCATGG + Intronic
954619439 3:51987149-51987171 CAAGGTTGTAAACTCCATCCTGG + Exonic
958437057 3:94109642-94109664 AAAGTTGGTGGATTCCACCATGG + Intronic
963648527 3:147947065-147947087 CACCGTTGTAAACTCCACCAAGG - Intergenic
963865160 3:150352683-150352705 CAATCAGGTGAACTCCATCAAGG - Intergenic
973845005 4:54902600-54902622 CAGGATGGTGAACTACAACAAGG + Intergenic
978112492 4:104979119-104979141 CAGGGTGGTGAGTTCCCCCAGGG - Intergenic
982616514 4:157644091-157644113 CAAAGCGGTGAACTCCACTTGGG + Intergenic
993849044 5:92983024-92983046 CAGAGTGGTGGGCTCCACCAAGG - Intergenic
995943771 5:117617445-117617467 CAAGGTAGTAAATACCACCATGG + Intergenic
997885283 5:137624781-137624803 CAAGGAACTGAACTACACCATGG + Intronic
998625478 5:143841053-143841075 CATGGTGGCCAACTCCTCCAAGG + Intergenic
999286340 5:150396484-150396506 GAAGGTGGTGGACACCACCAAGG + Exonic
1000901953 5:166921789-166921811 CAAGATAGTGAGCTCCACAAGGG + Intergenic
1002154608 5:177266555-177266577 CGAGGTCGTGAACTGCATCATGG - Intronic
1002876780 6:1217754-1217776 CAGGGTGGGGAAGTCCTCCAAGG + Intergenic
1006485250 6:34334587-34334609 CAAGATCGTGCACTCCAGCATGG + Intronic
1006667248 6:35704358-35704380 TAAGGTGCTGAACTCCACTGTGG + Intronic
1007342165 6:41198208-41198230 CAAGGTGGTCAACATCACCATGG - Exonic
1007348282 6:41249529-41249551 CAAGGTGGTCAACATCACCATGG + Intergenic
1010764064 6:79758459-79758481 CAAGGTGGAGAATTCCATGAGGG + Intergenic
1015478167 6:133676838-133676860 CAAGGGAGTGACTTCCACCAAGG - Intergenic
1015933103 6:138382505-138382527 CCAGGGGGTGAGCTCCACCCAGG + Exonic
1017955641 6:159175579-159175601 AAATGTGTTGAACTCCAACAAGG + Intronic
1018172085 6:161151504-161151526 CAAGCTGGGCAACCCCACCAGGG + Intronic
1019055769 6:169222253-169222275 CAAGGTGGTGAACTCCACCACGG - Exonic
1020022500 7:4877608-4877630 CAAGGAGGTGGACACCATCACGG - Exonic
1022392926 7:29959209-29959231 CAAGATGGTGAACACAACCCTGG + Intronic
1027516443 7:79147834-79147856 CAAGGAGGTGATCTGCACCCAGG - Intronic
1030646531 7:112067447-112067469 CAGGGTGGTGAACTCTAAGAAGG + Intronic
1032823741 7:135549277-135549299 CAATGTGGTGAACACTGCCATGG + Intergenic
1034072841 7:148203693-148203715 CAAGGTCGTGTACTCCAGCCTGG + Intronic
1034951877 7:155303578-155303600 AAAGGTAGTGAACTCCAGGATGG + Intronic
1039289402 8:36077608-36077630 CACTGTGGTGAACTCCTGCACGG + Intergenic
1039675921 8:39666963-39666985 CAACATGGTGAACTTCACTATGG + Intronic
1045934885 8:107667838-107667860 AAAGCTGGTGAACTAGACCAAGG - Intergenic
1047193255 8:122698016-122698038 AAAGGAGGTGGACTCCAGCATGG - Intergenic
1048831497 8:138481961-138481983 CCAGATGGTGAACTCCTCCAGGG - Intronic
1049093603 8:140534952-140534974 CAAGGTGGTAACCAACACCATGG + Intronic
1052075904 9:24140175-24140197 CAAGGTGATTTTCTCCACCACGG + Intergenic
1052249663 9:26382816-26382838 CAAGGTGGTTGACTGCAGCAAGG + Intergenic
1056757136 9:89388841-89388863 CAAGGAGGGGGACTCCACCCAGG + Intronic
1057999401 9:99849860-99849882 CAAGGTGTTGAGTGCCACCATGG + Intronic
1061271686 9:129547266-129547288 CACGCTGGGGAATTCCACCAGGG + Intergenic
1190780854 X:53593462-53593484 GAAGATGGTGAATCCCACCACGG - Exonic
1191137712 X:57083352-57083374 CAAGGTGATGAACGCCCACAGGG + Intergenic
1194784757 X:98068878-98068900 CATGGTGCTGAAATCAACCATGG + Intergenic
1195443247 X:104921498-104921520 CAGGGGGGTGAACTGCACCTAGG - Intronic