ID: 1019055772

View in Genome Browser
Species Human (GRCh38)
Location 6:169222266-169222288
Sequence CACCACCTTGAGGGACACGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 105}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019055765_1019055772 -3 Left 1019055765 6:169222246-169222268 CCCGTCCCCGTGGTGGAGTTCAC 0: 1
1: 0
2: 2
3: 5
4: 58
Right 1019055772 6:169222266-169222288 CACCACCTTGAGGGACACGCCGG 0: 1
1: 0
2: 1
3: 9
4: 105
1019055767_1019055772 -8 Left 1019055767 6:169222251-169222273 CCCCGTGGTGGAGTTCACCACCT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1019055772 6:169222266-169222288 CACCACCTTGAGGGACACGCCGG 0: 1
1: 0
2: 1
3: 9
4: 105
1019055766_1019055772 -4 Left 1019055766 6:169222247-169222269 CCGTCCCCGTGGTGGAGTTCACC 0: 1
1: 0
2: 2
3: 8
4: 70
Right 1019055772 6:169222266-169222288 CACCACCTTGAGGGACACGCCGG 0: 1
1: 0
2: 1
3: 9
4: 105
1019055768_1019055772 -9 Left 1019055768 6:169222252-169222274 CCCGTGGTGGAGTTCACCACCTT 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1019055772 6:169222266-169222288 CACCACCTTGAGGGACACGCCGG 0: 1
1: 0
2: 1
3: 9
4: 105
1019055762_1019055772 10 Left 1019055762 6:169222233-169222255 CCTCAGGTGCTCGCCCGTCCCCG 0: 1
1: 0
2: 0
3: 11
4: 243
Right 1019055772 6:169222266-169222288 CACCACCTTGAGGGACACGCCGG 0: 1
1: 0
2: 1
3: 9
4: 105
1019055759_1019055772 29 Left 1019055759 6:169222214-169222236 CCGTGTGCCACAGCGCGTTCCTC 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1019055772 6:169222266-169222288 CACCACCTTGAGGGACACGCCGG 0: 1
1: 0
2: 1
3: 9
4: 105
1019055758_1019055772 30 Left 1019055758 6:169222213-169222235 CCCGTGTGCCACAGCGCGTTCCT 0: 1
1: 0
2: 1
3: 9
4: 99
Right 1019055772 6:169222266-169222288 CACCACCTTGAGGGACACGCCGG 0: 1
1: 0
2: 1
3: 9
4: 105
1019055761_1019055772 22 Left 1019055761 6:169222221-169222243 CCACAGCGCGTTCCTCAGGTGCT 0: 1
1: 0
2: 1
3: 8
4: 87
Right 1019055772 6:169222266-169222288 CACCACCTTGAGGGACACGCCGG 0: 1
1: 0
2: 1
3: 9
4: 105
1019055769_1019055772 -10 Left 1019055769 6:169222253-169222275 CCGTGGTGGAGTTCACCACCTTG 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1019055772 6:169222266-169222288 CACCACCTTGAGGGACACGCCGG 0: 1
1: 0
2: 1
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019055772 Original CRISPR CACCACCTTGAGGGACACGC CGG Exonic
900568490 1:3347052-3347074 GACCACCTTGAGGGCCTCACAGG + Intronic
900666283 1:3817594-3817616 CCCCAGCTTTAGGGACACGAAGG - Intronic
902885273 1:19400322-19400344 CAAAACCCTGCGGGACACGCAGG + Intronic
903673147 1:25048171-25048193 CACCAACCTCAGGGACAGGCAGG + Intergenic
903736882 1:25535507-25535529 CAGCACATTGAGGGCCACCCAGG - Intergenic
904128989 1:28261602-28261624 CACCCCCTTGTGAGACACTCTGG - Intronic
904824701 1:33266672-33266694 CACCACCTTGAGGAACTGTCTGG - Intronic
914997560 1:152558366-152558388 GACAACCATGAGGGACACCCAGG + Intronic
921026704 1:211290622-211290644 CAGCACTTTGAGGGGCAGGCAGG - Intronic
1067776887 10:49170595-49170617 CACCACCTTGAGTCACTTGCAGG + Intronic
1072692717 10:97582462-97582484 CACCACCTGTAGGGGCCCGCAGG - Intronic
1076773245 10:132678757-132678779 CAGCACCTTGAAGGAAAGGCTGG + Intronic
1076846985 10:133074187-133074209 CACAACCTTGTAAGACACGCAGG - Intronic
1076909579 10:133380176-133380198 CACCAGCTGGAGGCTCACGCTGG - Exonic
1077282251 11:1751054-1751076 CACCACCTTCTGGGAGACCCTGG + Intronic
1087936364 11:104038032-104038054 TACCACCTTGAGGGAGCCTCAGG + Exonic
1089158737 11:116421909-116421931 CACCAGCTTGATGAACAGGCAGG + Intergenic
1090613851 11:128496910-128496932 CAACACAATGGGGGACACGCAGG + Intronic
1093289123 12:17300393-17300415 CACCATCTTTAGGGAGGCGCTGG + Intergenic
1094168820 12:27469566-27469588 CAGCACCCTGAGGGACAAGAGGG - Intronic
1102200651 12:111055629-111055651 CCCCACCTTGGGGGCCAGGCGGG - Intronic
1105437735 13:20391662-20391684 CACCACCTTGCGGAACAGGTCGG + Intergenic
1105704408 13:22960502-22960524 CGCCACCATCAGGGACACTCAGG - Intergenic
1112199810 13:97263462-97263484 CACTACCCTGAGGGACATGGTGG + Intronic
1113927646 13:113950503-113950525 GAACACCTTGAGGGGCAGGCAGG - Intergenic
1114820140 14:26008594-26008616 CCCAACCTTGAGGGACAAGATGG + Intergenic
1115028555 14:28768110-28768132 CACCACCTCGCGGGCCAAGCTGG + Exonic
1119753931 14:77100486-77100508 CAGCACTTTGAGGCACAGGCGGG - Intronic
1121817424 14:96939460-96939482 AACCACCCTGAGAGACAGGCAGG + Intergenic
1121819410 14:96954216-96954238 CATCACCTGGAGGGAGACTCTGG - Intergenic
1122722090 14:103727855-103727877 CGCCTCCTTGAGGGACACGAGGG - Exonic
1123832369 15:24154010-24154032 GACCACCTTGAGGAACATGGAGG - Intergenic
1128529834 15:68437005-68437027 CTCCACCTTGAGGCACTCCCTGG + Intergenic
1128750004 15:70141991-70142013 CTCCACCTTCAGCGCCACGCGGG - Intergenic
1129763537 15:78146609-78146631 CAGCAGCTGGAGGGACATGCAGG - Intronic
1131013724 15:89040686-89040708 CGGCACCCTGAGGGAGACGCAGG + Intergenic
1135167685 16:20155357-20155379 CACCACATCGAGGCACAAGCTGG + Intergenic
1136080857 16:27851873-27851895 CCCCACCTCGAGGGAGGCGCAGG - Intronic
1137271858 16:46907498-46907520 CACCGACCTGAGGGACACACAGG + Intronic
1137597341 16:49733707-49733729 CACCTCCCTGAGGGCCAGGCTGG - Intronic
1146282870 17:31556996-31557018 CACCACCTTTTGGGAAACGCTGG + Intergenic
1147652232 17:42069241-42069263 CTCCACATTGATGGACACACAGG - Intergenic
1148105515 17:45116682-45116704 CACCATCCTGGGGGACATGCTGG - Exonic
1152933567 17:83123099-83123121 GAGCTCCTTGAAGGACACGCTGG + Intergenic
1161247064 19:3258997-3259019 CAGCACCCTGAGGGAGAAGCAGG + Intronic
1162926715 19:13933867-13933889 CACCACCTTCAGGTACAGGCTGG - Exonic
1163439210 19:17313018-17313040 CACCACCCTCTGGGACAGGCAGG - Intronic
1166228530 19:41412026-41412048 CAGCACCCTGAGGGACACCCCGG - Intronic
925390916 2:3493324-3493346 CCCCTCCTTGGGGGACAGGCAGG + Intergenic
927787116 2:25981876-25981898 CACCACCTTGAGGGCCTCGCTGG + Exonic
928317362 2:30256462-30256484 CATCTGCTTGAGGGACAAGCTGG + Intronic
932374965 2:71227328-71227350 CACCTCCTTGAGGGAGATGCCGG + Intergenic
932682268 2:73836412-73836434 CCCCACCTTGAGGGCAGCGCGGG - Intronic
933223105 2:79714044-79714066 CACCAGGTGGAGGGACAAGCAGG - Intronic
937298567 2:120824524-120824546 AAGCACCTGGAGGGACACTCTGG - Intronic
943743895 2:191441146-191441168 CAGCACCTTGAGGGCCAAGGTGG - Intergenic
946932744 2:224687266-224687288 CATCACCTTGAGGGAAACACAGG - Intergenic
947687582 2:232102939-232102961 TACCACCTTGTGTGACACACTGG - Intronic
948737301 2:240017325-240017347 CACCAGCCTGTGGCACACGCAGG + Intronic
1170420300 20:16186023-16186045 TTCACCCTTGAGGGACACGCAGG - Intergenic
1174354676 20:49989930-49989952 GACGACCTAGAGGGACCCGCAGG - Intergenic
1176240603 20:64074141-64074163 CACCTCCTTGGGGGACAGGATGG + Exonic
1179423824 21:41256917-41256939 CACCACCTGGAGTTACACACAGG - Intronic
1181808688 22:25390694-25390716 CCCCACCATGAGGACCACGCAGG + Intronic
1182035298 22:27193690-27193712 CAGCTCCTTGAGGGAAACACTGG - Intergenic
1182149819 22:28020115-28020137 CACCACCTTTAGGGACACAGCGG - Intronic
1183126278 22:35784735-35784757 CACCATCTTGAGGGCCATGGTGG + Intronic
1183218612 22:36497408-36497430 CACCAAGTTCAGGGACATGCAGG - Intronic
1184254245 22:43278143-43278165 CCCCACCTTGAGGGCCATTCCGG + Intronic
1184759134 22:46535137-46535159 CAGCACCGTGATGGACACGCTGG + Exonic
949187210 3:1206460-1206482 CAATACCTTGAGTGACACCCTGG - Intronic
953233773 3:41088034-41088056 CAACACCTAGAAGGACACGTGGG + Intergenic
953888602 3:46734193-46734215 CACCACCCTGCAGGACACGTTGG + Exonic
956334283 3:68145974-68145996 CACAAGCTTGAGGGACAGGGAGG - Intronic
959874735 3:111369305-111369327 CACCACCTTGTGGGACTTGCAGG + Intronic
960616560 3:119600909-119600931 CACCACCTTCAGGCCCAGGCTGG - Intronic
963467218 3:145698568-145698590 CACCACCTTGAAAGACAGACTGG + Intergenic
968644482 4:1732733-1732755 CACCTCCCCGAGGGAGACGCCGG - Intronic
969276030 4:6136426-6136448 CACGACGTTGAGGGACCTGCTGG + Intronic
969609107 4:8217104-8217126 CACCTCCTCGGAGGACACGCTGG - Exonic
973264967 4:48201768-48201790 CTCCACCTGGAGAGACAAGCTGG + Intronic
978416489 4:108482319-108482341 CACCACCTTGTGGGCCAACCAGG - Intergenic
982109559 4:152041394-152041416 CTCCACCAGGAGGGAGACGCTGG - Intergenic
982374551 4:154675045-154675067 CTCCAGCTTGAAGGACAAGCTGG - Intronic
983475743 4:168209448-168209470 CACCAGCTTGAGAGCCAGGCAGG - Intergenic
988452003 5:31352638-31352660 CACCACGTGGAGGGACATCCTGG + Intergenic
992479712 5:77138349-77138371 AACCACCCTGAGGGACAAGAGGG - Intergenic
994411503 5:99411943-99411965 ATCCACCTTGAGGGGCAGGCAGG - Intergenic
994482325 5:100353304-100353326 ATCCACCTTGAGGGGCAGGCAGG + Intergenic
998279924 5:140796280-140796302 GGCCACCTCGATGGACACGCTGG - Exonic
998283486 5:140835555-140835577 CACCAACTTGAAGGGAACGCGGG - Exonic
998370724 5:141659407-141659429 CACCACCTGGAAGGACGTGCAGG - Exonic
1002772921 6:304488-304510 CACCTCCCTGACAGACACGCGGG - Intronic
1006151989 6:31994625-31994647 CACCACCTTCAGAGACACAGCGG - Exonic
1006158291 6:32027363-32027385 CACCACCTTCAGAGACACAGCGG - Exonic
1012069665 6:94597607-94597629 CACCATCTTGAGGGGCATGGAGG - Intergenic
1018981794 6:168607096-168607118 CACCAGCATGAAGGAGACGCCGG - Intronic
1019055772 6:169222266-169222288 CACCACCTTGAGGGACACGCCGG + Exonic
1021551622 7:21877134-21877156 CTCCACTGTGAGGGACACCCAGG - Intronic
1022956824 7:35388968-35388990 GACCACCTTTAGAGACACACAGG + Intergenic
1024292049 7:47811916-47811938 CTCCACTCTCAGGGACACGCTGG + Exonic
1027381217 7:77611956-77611978 CAGCACCTTCAGGGACAAGGTGG - Intronic
1031106170 7:117545495-117545517 AAGAACCTTGAGGTACACGCAGG - Intronic
1034124892 7:148662635-148662657 CACCTCCTTGAGGGTCAAGGGGG + Intergenic
1034437458 7:151069983-151070005 CACCACCTGGTGGGCCACTCCGG - Exonic
1034546922 7:151795184-151795206 CAGCACCTAGAGGGACAGGTTGG + Intronic
1035545017 8:473622-473644 CACCAGCTGGAGGGGCAAGCAGG + Intergenic
1041253115 8:55953922-55953944 CACCAACTTGATGGACTCCCGGG - Exonic
1041254991 8:55972318-55972340 CGCCACCTTGAGGGAAGGGCTGG - Intronic
1059417666 9:114171942-114171964 CAGCTCCTTCAGGAACACGCTGG - Intronic
1060027778 9:120187534-120187556 GAGCTCCTTGTGGGACACGCTGG - Intergenic
1185798591 X:2988246-2988268 CAACACCTTGAGAAACAGGCAGG - Intergenic
1188934835 X:36161599-36161621 CACCACGTTGAGGAAGACGACGG + Intergenic
1189138926 X:38580766-38580788 CACGACCTTGGGGCACACTCTGG - Intronic
1193875786 X:86861296-86861318 CCTCACCTTTAGGGACCCGCTGG - Intergenic
1199216062 X:145261667-145261689 TACTACCTAGAGGGAGACGCCGG - Intergenic